Incidental Mutation 'R1065:Il1b'
List |< first << previous [record 11 of 36] next >> last >|
ID85953
Institutional Source Beutler Lab
Gene Symbol Il1b
Ensembl Gene ENSMUSG00000027398
Gene Nameinterleukin 1 beta
SynonymsIL-1B, IL-1beta
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129364570-129371139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129368007 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 83 (T83I)
Ref Sequence ENSEMBL: ENSMUSP00000028881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028881]
PDB Structure
THE STRUCTURE OF MURINE INTERLEUKIN-1 BETA AT 2.8 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
A COMPARISON OF THE HIGH RESOLUTION STRUCTURES OF HUMAN AND MURINE INTERLEUKIN-1B [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028881
AA Change: T83I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028881
Gene: ENSMUSG00000027398
AA Change: T83I

DomainStartEndE-ValueType
Pfam:IL1_propep 1 102 3.3e-37 PFAM
IL1 120 265 1.74e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156601
Meta Mutation Damage Score 0.1132 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1. The encoded protein plays a role in thymocyte proliferation and is involved in the inflammatory response. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants show impaired contact hypersensitivity and reduced acute-phase inflammatory response. Lung tumors and metastases of B16 melanoma do not occur in null mutant mice, suggesting inability to support tumor invasiveness and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Il1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Il1b APN 2 129367333 missense possibly damaging 0.82
IGL01488:Il1b APN 2 129367234 splice site probably benign
IGL01810:Il1b APN 2 129369729 missense probably damaging 1.00
IGL02041:Il1b APN 2 129369742 missense possibly damaging 0.95
IGL02726:Il1b APN 2 129367322 missense probably damaging 1.00
IGL02793:Il1b APN 2 129367251 missense probably benign 0.00
IGL02875:Il1b APN 2 129367251 missense probably benign 0.00
IGL02884:Il1b APN 2 129365102 missense probably benign 0.02
R1656:Il1b UTSW 2 129366069 missense probably damaging 0.99
R1761:Il1b UTSW 2 129365181 missense probably damaging 1.00
R2166:Il1b UTSW 2 129365048 missense probably damaging 0.97
R2568:Il1b UTSW 2 129367322 missense probably damaging 1.00
R4807:Il1b UTSW 2 129370306 missense probably benign 0.00
R7684:Il1b UTSW 2 129367357 missense probably benign 0.03
Z1177:Il1b UTSW 2 129369745 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGCAAGTCAATGGTTGAGTTGCAAG -3'
(R):5'- TTCTCCACAGGGCTGCTTCCAAAC -3'

Sequencing Primer
(F):5'- TGAGTTGCAAGTGTAAGCATC -3'
(R):5'- AAACCTTTGACCTGGGCTG -3'
Posted On2013-11-18