Incidental Mutation 'R4191:Donson'
List |< first << previous [record 12 of 51] next >> last >|
ID371073
Institutional Source Beutler Lab
Gene Symbol Donson
Ensembl Gene ENSMUSG00000022960
Gene Namedownstream neighbor of SON
SynonymsDonson, ORF60, 1110025J21Rik
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4191 (G1)
Quality Score71
Status Validated
Chromosome16
Chromosomal Location91676808-91688770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91688592 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 41 (A41S)
Ref Sequence ENSEMBL: ENSMUSP00000123648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023682] [ENSMUST00000073466] [ENSMUST00000114031] [ENSMUST00000117159] [ENSMUST00000117644] [ENSMUST00000122254] [ENSMUST00000124282] [ENSMUST00000133942] [ENSMUST00000136699] [ENSMUST00000138560] [ENSMUST00000139324] [ENSMUST00000144461] [ENSMUST00000145833] [ENSMUST00000159295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023682
AA Change: A41S

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023682
Gene: ENSMUSG00000022960
AA Change: A41S

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073466
SMART Domains Protein: ENSMUSP00000073171
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 142 3.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114031
AA Change: A41S

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109665
Gene: ENSMUSG00000022960
AA Change: A41S

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117159
AA Change: A41S

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113220
Gene: ENSMUSG00000022960
AA Change: A41S

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 340 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117644
SMART Domains Protein: ENSMUSP00000113227
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_zinc_N 141 212 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122254
SMART Domains Protein: ENSMUSP00000112734
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 71 150 1e-9 BLAST
SCOP:d1heta1 73 137 4e-12 SMART
low complexity region 172 190 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123893
Predicted Effect probably benign
Transcript: ENSMUST00000124282
SMART Domains Protein: ENSMUSP00000115686
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Pfam:ADH_N 30 150 1.7e-8 PFAM
Pfam:ADH_zinc_N 156 227 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133942
SMART Domains Protein: ENSMUSP00000121386
Gene: ENSMUSG00000022960

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136699
Predicted Effect probably benign
Transcript: ENSMUST00000138560
AA Change: A38S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121591
Gene: ENSMUSG00000022960
AA Change: A38S

DomainStartEndE-ValueType
low complexity region 31 52 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 310 331 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139324
AA Change: A41S

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120957
Gene: ENSMUSG00000022960
AA Change: A41S

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140199
Predicted Effect possibly damaging
Transcript: ENSMUST00000144461
AA Change: A41S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123648
Gene: ENSMUSG00000022960
AA Change: A41S

DomainStartEndE-ValueType
low complexity region 34 55 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144472
SMART Domains Protein: ENSMUSP00000116833
Gene: ENSMUSG00000058240

DomainStartEndE-ValueType
Blast:PKS_ER 2 152 8e-13 BLAST
PDB:3SLK|B 2 152 3e-10 PDB
SCOP:d1heta1 24 103 1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156242
Predicted Effect probably benign
Transcript: ENSMUST00000159295
SMART Domains Protein: ENSMUSP00000125172
Gene: ENSMUSG00000116933

DomainStartEndE-ValueType
Pfam:OSCP 1 89 1.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232491
Meta Mutation Damage Score 0.1005 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies downstream of the SON gene and spans 10 kb on chromosome 21. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout is early embryonic lethal. Heterozygous knockout causes no observable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Donson
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Donson APN 16 91682591 missense possibly damaging 0.79
IGL02458:Donson APN 16 91681176 missense probably damaging 0.97
IGL03238:Donson APN 16 91681246 nonsense probably null
IGL02802:Donson UTSW 16 91681308 missense possibly damaging 0.66
R0525:Donson UTSW 16 91686245 missense probably damaging 1.00
R0831:Donson UTSW 16 91683763 missense probably damaging 1.00
R3706:Donson UTSW 16 91686161 unclassified probably benign
R4746:Donson UTSW 16 91682237 missense probably damaging 1.00
R4788:Donson UTSW 16 91687833 missense possibly damaging 0.66
R4947:Donson UTSW 16 91682551 missense probably damaging 1.00
R5171:Donson UTSW 16 91681293 missense possibly damaging 0.93
R5439:Donson UTSW 16 91679926 missense probably damaging 0.99
R5739:Donson UTSW 16 91681229 splice site probably null
R5809:Donson UTSW 16 91687850 missense possibly damaging 0.69
R6964:Donson UTSW 16 91681219 missense probably benign 0.11
R7022:Donson UTSW 16 91681330 missense probably damaging 1.00
R7110:Donson UTSW 16 91682121 nonsense probably null
R7326:Donson UTSW 16 91688711 start codon destroyed probably null 0.99
R7826:Donson UTSW 16 91688456 missense possibly damaging 0.90
Z1177:Donson UTSW 16 91688472 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTTACAGGAGAGGGCAGC -3'
(R):5'- GCCGAGTTGGTACTGTTAATCCC -3'

Sequencing Primer
(F):5'- AGCTCAGGACATCAGCCTG -3'
(R):5'- ACCGGGAAATCTGTTGGGC -3'
Posted On2016-02-12