Incidental Mutation 'R4191:Maml3'
List |< first << previous [record 19 of 51] next >> last >|
ID318301
Institutional Source Beutler Lab
Gene Symbol Maml3
Ensembl Gene ENSMUSG00000061143
Gene Namemastermind like transcriptional coactivator 3
Synonyms
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51685907-52105076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51689969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1098 (V1098A)
Ref Sequence ENSEMBL: ENSMUSP00000112637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118075] [ENSMUST00000121440]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099104
Predicted Effect probably benign
Transcript: ENSMUST00000118075
AA Change: V452A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113677
Gene: ENSMUSG00000061143
AA Change: V452A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
coiled coil region 90 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121440
AA Change: V1098A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112637
Gene: ENSMUSG00000061143
AA Change: V1098A

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
low complexity region 12 32 N/A INTRINSIC
low complexity region 44 65 N/A INTRINSIC
MamL-1 67 126 6.54e-30 SMART
low complexity region 436 454 N/A INTRINSIC
coiled coil region 459 502 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 621 647 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
coiled coil region 736 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193403
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Maml3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Maml3 APN 3 51690704 missense probably benign 0.13
IGL01138:Maml3 APN 3 51690558 missense possibly damaging 0.87
IGL02173:Maml3 APN 3 51690787 missense probably damaging 0.96
IGL02220:Maml3 APN 3 51690218 missense possibly damaging 0.94
IGL02725:Maml3 APN 3 52103774 missense probably damaging 0.97
IGL02838:Maml3 APN 3 51690090 missense probably damaging 1.00
R0683:Maml3 UTSW 3 51856752 nonsense probably null
R1966:Maml3 UTSW 3 52104139 missense unknown
R1980:Maml3 UTSW 3 52104052 missense unknown
R1989:Maml3 UTSW 3 51697758 missense probably damaging 0.98
R1992:Maml3 UTSW 3 51690757 missense probably benign 0.01
R2047:Maml3 UTSW 3 51690445 missense probably damaging 1.00
R2113:Maml3 UTSW 3 51690656 missense probably damaging 1.00
R2876:Maml3 UTSW 3 51690059 missense possibly damaging 0.86
R3176:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R3276:Maml3 UTSW 3 51856930 missense possibly damaging 0.62
R4576:Maml3 UTSW 3 51856506 nonsense probably null
R4609:Maml3 UTSW 3 51855592 missense probably damaging 1.00
R4628:Maml3 UTSW 3 51796470 intron probably benign
R4734:Maml3 UTSW 3 51689875 missense probably damaging 1.00
R4776:Maml3 UTSW 3 51856532 missense probably benign 0.28
R4868:Maml3 UTSW 3 52103924 nonsense probably null
R4889:Maml3 UTSW 3 51694510 intron probably benign
R4891:Maml3 UTSW 3 51694510 intron probably benign
R4947:Maml3 UTSW 3 51856539 missense probably benign 0.01
R5011:Maml3 UTSW 3 51690775 missense possibly damaging 0.87
R5047:Maml3 UTSW 3 51690841 missense possibly damaging 0.88
R5344:Maml3 UTSW 3 52103725 missense probably damaging 0.99
R5743:Maml3 UTSW 3 52104132 missense unknown
R6724:Maml3 UTSW 3 51855875 missense probably damaging 1.00
R6885:Maml3 UTSW 3 51697579
R6938:Maml3 UTSW 3 52103738 missense probably damaging 0.98
R7581:Maml3 UTSW 3 51856768 missense probably benign 0.06
R7895:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R7978:Maml3 UTSW 3 51697722 missense probably damaging 1.00
R8059:Maml3 UTSW 3 51856689 missense probably damaging 1.00
RF022:Maml3 UTSW 3 51856662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCGGATGTCATGTTCTC -3'
(R):5'- CATTGGTCATGCCTGGTCTG -3'

Sequencing Primer
(F):5'- AGCCGGATGTCATGTTCTCAATTTAC -3'
(R):5'- TCTGAGCCAGGGTGTCC -3'
Posted On2015-06-10