Incidental Mutation 'R0766:4921539E11Rik'
List |< first << previous [record 2 of 37] next >> last >|
ID69493
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene NameRIKEN cDNA 4921539E11 gene
Synonyms
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location103230445-103290863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103270797 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 44 (F44I)
Ref Sequence ENSEMBL: ENSMUSP00000095557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
Predicted Effect probably damaging
Transcript: ENSMUST00000030245
AA Change: F44I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520
AA Change: F44I

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097944
AA Change: F44I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520
AA Change: F44I

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168664
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Meta Mutation Damage Score 0.2271 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
BB004:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
BB014:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1312:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6518:4921539E11Rik UTSW 4 103266411 missense probably damaging 1.00
R6602:4921539E11Rik UTSW 4 103255572 missense probably benign 0.36
R6634:4921539E11Rik UTSW 4 103236930 critical splice donor site probably null
R6992:4921539E11Rik UTSW 4 103242793 missense possibly damaging 0.57
R7575:4921539E11Rik UTSW 4 103230995 missense probably damaging 1.00
R7927:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R8130:4921539E11Rik UTSW 4 103235698 missense probably damaging 1.00
R8461:4921539E11Rik UTSW 4 103255515 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCAGCTACACCAGCCTCAA -3'
(R):5'- gtgtgtTTAGAGAGAAAGGGAGAATGATTCA -3'

Sequencing Primer
(F):5'- cccttgcctctaccttctg -3'
(R):5'- AGAATACTGACCGTCACCAC -3'
Posted On2013-09-30