Incidental Mutation 'R4408:Olfr466'
List |< first << previous [record 20 of 32] next >> last >|
ID327769
Institutional Source Beutler Lab
Gene Symbol Olfr466
Ensembl Gene ENSMUSG00000049806
Gene Nameolfactory receptor 466
SynonymsGA_x6K02T2PB7A-3051266-3052192, MOR209-1
MMRRC Submission 041690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4408 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65150240-65156152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65152700 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000149328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058907] [ENSMUST00000214214]
Predicted Effect probably benign
Transcript: ENSMUST00000058907
AA Change: T159A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062692
Gene: ENSMUSG00000049806
AA Change: T159A

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 2.8e-47 PFAM
Pfam:7tm_1 39 288 3.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214214
AA Change: T159A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1h A G 17: 25,380,627 V1588A probably damaging Het
Card6 T A 15: 5,101,054 M287L probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbln1 T A 15: 85,231,556 probably null Het
Fndc5 A G 4: 129,142,529 probably null Het
Gm10799 C A 2: 104,068,064 A99S possibly damaging Het
Gm27013 A T 6: 130,677,765 S245T possibly damaging Het
Gm5592 A G 7: 41,286,448 T125A probably benign Het
Gml2 T C 15: 74,824,339 probably benign Het
Gpbp1 A T 13: 111,448,964 N149K possibly damaging Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Hnrnpu T C 1: 178,330,803 probably benign Het
Irf5 A G 6: 29,534,001 probably null Het
Lrp2 T A 2: 69,467,169 K3149N probably benign Het
Lrrn3 A G 12: 41,454,042 V92A probably benign Het
Map3k12 T C 15: 102,505,402 T45A probably damaging Het
Myof A G 19: 37,922,978 S1502P probably damaging Het
Olfr1283 T A 2: 111,369,280 I216K possibly damaging Het
Osr2 T C 15: 35,300,471 Y58H possibly damaging Het
Pop5 C T 5: 115,240,777 probably benign Het
Ror2 A G 13: 53,118,961 C211R probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sgsm2 C A 11: 74,851,766 R957L probably damaging Het
Slc16a11 A G 11: 70,215,734 probably null Het
Spag17 T A 3: 100,103,378 Y2063N probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn1r23 T C 6: 57,926,368 I142V probably benign Het
Vmn1r235 A G 17: 21,261,592 K60E probably damaging Het
Vmn2r33 A C 7: 7,551,230 F775V probably damaging Het
Vps13b C T 15: 35,709,294 P1796S probably damaging Het
Vwa3a G A 7: 120,778,926 V480I probably benign Het
Other mutations in Olfr466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Olfr466 APN 13 65152396 missense probably damaging 0.99
R0269:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0617:Olfr466 UTSW 13 65152878 missense possibly damaging 0.56
R0646:Olfr466 UTSW 13 65153063 missense probably damaging 1.00
R1338:Olfr466 UTSW 13 65152383 missense probably damaging 1.00
R1893:Olfr466 UTSW 13 65152992 missense possibly damaging 0.92
R3108:Olfr466 UTSW 13 65153061 missense possibly damaging 0.89
R4625:Olfr466 UTSW 13 65152860 missense possibly damaging 0.95
R4732:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4733:Olfr466 UTSW 13 65152653 missense possibly damaging 0.72
R4849:Olfr466 UTSW 13 65152679 missense possibly damaging 0.96
R5058:Olfr466 UTSW 13 65152929 missense possibly damaging 0.96
R5419:Olfr466 UTSW 13 65152774 missense probably damaging 1.00
R5569:Olfr466 UTSW 13 65152979 missense possibly damaging 0.81
R5662:Olfr466 UTSW 13 65152253 missense possibly damaging 0.76
R7292:Olfr466 UTSW 13 65152842 missense possibly damaging 0.94
R7345:Olfr466 UTSW 13 65152743 missense possibly damaging 0.59
R7427:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R7428:Olfr466 UTSW 13 65153052 missense probably damaging 1.00
R8162:Olfr466 UTSW 13 65152920 missense probably damaging 0.99
R8736:Olfr466 UTSW 13 65152724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTAGTGGGTGTGCCAC -3'
(R):5'- CACTGTGCGGATCTTCAATATTG -3'

Sequencing Primer
(F):5'- TGGGTGTGCCACACAATTC -3'
(R):5'- CAAGAAGAACCAGCTGGTT -3'
Posted On2015-07-07