Incidental Mutation 'R3936:Sf3a1'
List |< first << previous [record 24 of 31] next >> last >|
ID307178
Institutional Source Beutler Lab
Gene Symbol Sf3a1
Ensembl Gene ENSMUSG00000002129
Gene Namesplicing factor 3a, subunit 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3936 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location4160350-4182541 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 4180024 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002198]
PDB Structure
Solution structure of Ubiquitin-like domain in SF3a120 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000002198
SMART Domains Protein: ENSMUSP00000002198
Gene: ENSMUSG00000002129

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SWAP 50 103 4.99e-30 SMART
low complexity region 118 138 N/A INTRINSIC
SWAP 164 217 3.22e-24 SMART
Pfam:PRP21_like_P 227 469 7e-81 PFAM
low complexity region 552 560 N/A INTRINSIC
low complexity region 574 589 N/A INTRINSIC
low complexity region 624 673 N/A INTRINSIC
UBQ 713 784 6.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133095
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the splicing factor 3a protein complex. The splicing factor 3a heterotrimer is a component of the mature U2 small nuclear ribonucleoprotein particle (snRNP). U2 small nuclear ribonucleoproteins play a critical role in spliceosome assembly and pre-mRNA splicing. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
Ank3 A T 10: 69,879,989 K491* probably null Het
Arx T A X: 93,297,369 L554Q probably damaging Het
Axdnd1 T C 1: 156,331,639 N203S probably benign Het
Baz2b A G 2: 59,912,761 V1622A possibly damaging Het
Btnl6 T A 17: 34,517,342 H4L probably benign Het
Dync2h1 C A 9: 7,001,482 L3835F probably damaging Het
Fcgbp T C 7: 28,075,399 F133L probably benign Het
Fnip1 A G 11: 54,480,239 probably null Het
G6pc A G 11: 101,374,603 I154V probably benign Het
Golgb1 G T 16: 36,914,056 E1222* probably null Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Gzmk A T 13: 113,173,025 S164T probably damaging Het
Il22ra2 T A 10: 19,631,708 S156R probably benign Het
Kansl1 A T 11: 104,343,543 D712E possibly damaging Het
Mc3r T A 2: 172,249,296 I146N probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Olfr156 T A 4: 43,821,359 M1L probably benign Het
P4hb A C 11: 120,562,409 H440Q probably benign Het
Pbsn T C X: 77,848,096 T32A probably damaging Het
Rptn A C 3: 93,395,576 H72P possibly damaging Het
Scn1a T C 2: 66,327,776 I418V probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc9c1 A G 16: 45,606,830 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Sult2b1 C T 7: 45,742,216 V49M probably benign Het
Tlr11 A G 14: 50,362,735 E726G possibly damaging Het
Treh C T 9: 44,684,543 R342W probably benign Het
Other mutations in Sf3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sf3a1 APN 11 4171063 missense probably damaging 1.00
IGL02883:Sf3a1 APN 11 4179192 missense probably damaging 1.00
IGL03061:Sf3a1 APN 11 4175493 missense probably damaging 1.00
R1469:Sf3a1 UTSW 11 4175380 splice site probably benign
R1561:Sf3a1 UTSW 11 4179217 missense probably benign
R1905:Sf3a1 UTSW 11 4176678 missense probably benign 0.01
R1993:Sf3a1 UTSW 11 4179177 missense possibly damaging 0.51
R2264:Sf3a1 UTSW 11 4177443 missense probably benign 0.28
R3935:Sf3a1 UTSW 11 4180024 splice site probably null
R4065:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4067:Sf3a1 UTSW 11 4167824 missense probably damaging 1.00
R4245:Sf3a1 UTSW 11 4167774 missense probably damaging 1.00
R5167:Sf3a1 UTSW 11 4177456 missense possibly damaging 0.71
R5434:Sf3a1 UTSW 11 4174041 missense probably damaging 1.00
R7471:Sf3a1 UTSW 11 4167724 missense possibly damaging 0.94
R7506:Sf3a1 UTSW 11 4177561 missense probably benign 0.02
R7943:Sf3a1 UTSW 11 4166537 missense possibly damaging 0.46
R8039:Sf3a1 UTSW 11 4167787 missense probably damaging 1.00
R8074:Sf3a1 UTSW 11 4175435 nonsense probably null
R8299:Sf3a1 UTSW 11 4179420 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGAAGTCAGCTGTGCCTTTTAG -3'
(R):5'- CTGGAATTGGTGGTGCAAAG -3'

Sequencing Primer
(F):5'- TGGCTAATGTTTGGGAAGTTGAAAAC -3'
(R):5'- GAGGTACAATGGCAAGGTTTCAATTG -3'
Posted On2015-04-17