Incidental Mutation 'R0724:H2-Eb1'
List |< first << previous [record 26 of 55] next >> last >|
ID262017
Institutional Source Beutler Lab
Gene Symbol H2-Eb1
Ensembl Gene ENSMUSG00000060586
Gene Namehistocompatibility 2, class II antigen E beta
SynonymsH-2Eb, Ia-4, Ia4
MMRRC Submission 038906-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0724 (G1)
Quality Score70
Status Validated
Chromosome17
Chromosomal Location34305877-34316199 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 34315032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074557]
Predicted Effect probably benign
Transcript: ENSMUST00000074557
SMART Domains Protein: ENSMUSP00000074143
Gene: ENSMUSG00000060586

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MHC_II_beta 40 114 4.64e-47 SMART
IGc1 139 210 2.24e-24 SMART
transmembrane domain 226 248 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. DRB1 is expressed at a level five times higher than its paralogues DRB3, DRB4 and DRB5. The presence of DRB5 is linked with allelic variants of DRB1, otherwise it is omitted. There are 4 related pseudogenes: DRB2, DRB6, DRB7, DRB8 and DRB9. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik A G 5: 145,044,763 E136G probably benign Het
Adgre4 T A 17: 55,852,281 S655R probably benign Het
Ak7 T A 12: 105,710,254 V71E probably benign Het
Ank2 C T 3: 126,962,337 R1077H probably damaging Het
Anxa3 A G 5: 96,828,748 T198A possibly damaging Het
Atp1a1 A T 3: 101,592,439 I109N possibly damaging Het
Camta1 A G 4: 151,077,892 I119T probably damaging Het
Carm1 A G 9: 21,587,374 Y504C probably damaging Het
Casp1 C T 9: 5,303,077 P177L probably benign Het
Ccdc122 C A 14: 77,092,077 probably benign Het
Ces1a A G 8: 93,039,513 S158P probably damaging Het
Ces3a T A 8: 105,050,195 D103E possibly damaging Het
Clstn1 A C 4: 149,643,624 D583A possibly damaging Het
Corin A G 5: 72,332,795 probably benign Het
Cryba1 T C 11: 77,719,457 D144G probably damaging Het
Cwf19l2 G T 9: 3,421,377 probably null Het
Dis3l T C 9: 64,307,126 T1027A possibly damaging Het
Dopey2 A G 16: 93,762,325 E653G probably benign Het
Dst A G 1: 34,188,677 I1459V probably benign Het
Dyrk3 T C 1: 131,130,140 T64A probably benign Het
Emp2 C T 16: 10,284,615 C111Y probably benign Het
Enam A G 5: 88,501,994 Y454C probably damaging Het
Fbn1 A T 2: 125,352,064 C1328S probably benign Het
Gata3 T C 2: 9,874,575 T197A probably benign Het
Gm1043 A G 5: 37,187,229 T212A probably damaging Het
Gm15448 T C 7: 3,816,872 N564S possibly damaging Het
Hand1 T C 11: 57,831,680 H36R probably damaging Het
Hmgcs2 C A 3: 98,297,001 Y239* probably null Het
Hoxc12 A G 15: 102,937,055 Y68C probably damaging Het
Inpp5a A G 7: 139,516,663 I143V probably benign Het
Klhdc2 C A 12: 69,297,048 F18L probably benign Het
Kpnb1 T C 11: 97,178,304 Y251C probably damaging Het
Lrch4 A T 5: 137,637,308 N315I probably damaging Het
Map3k10 A C 7: 27,668,355 V286G probably damaging Het
Myo7b G A 18: 32,005,549 probably benign Het
Nlrp2 G T 7: 5,319,222 L809I probably damaging Het
Oacyl T C 18: 65,737,825 probably benign Het
Olfr735 A G 14: 50,345,917 V175A possibly damaging Het
Paxbp1 T A 16: 91,036,536 D270V probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Plcb3 G A 19: 6,963,392 R359C probably damaging Het
Plcxd3 G A 15: 4,516,868 S118N probably damaging Het
Ptpn14 T C 1: 189,850,947 S664P possibly damaging Het
Sirt1 T C 10: 63,323,973 I443V possibly damaging Het
Slc7a8 G A 14: 54,735,186 probably benign Het
Smim14 A G 5: 65,453,339 probably benign Het
Sost C T 11: 101,966,918 C19Y probably benign Het
Tcaf1 G T 6: 42,675,367 A727E probably damaging Het
Thoc1 T C 18: 9,963,829 L144P probably damaging Het
Tmem132b A T 5: 125,783,421 T577S possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tshr T C 12: 91,538,286 F666S probably damaging Het
Wdr1 A G 5: 38,540,862 V192A possibly damaging Het
Zfp697 T C 3: 98,428,166 W416R probably damaging Het
Other mutations in H2-Eb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0763:H2-Eb1 UTSW 17 34314159 splice site probably benign
R2029:H2-Eb1 UTSW 17 34314392 missense probably damaging 1.00
R3155:H2-Eb1 UTSW 17 34314374 missense probably damaging 0.98
R3440:H2-Eb1 UTSW 17 34309681 missense probably damaging 1.00
R4050:H2-Eb1 UTSW 17 34314368 missense probably damaging 1.00
R4084:H2-Eb1 UTSW 17 34314443 missense probably damaging 0.98
R5605:H2-Eb1 UTSW 17 34309833 missense probably benign 0.09
R5667:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5671:H2-Eb1 UTSW 17 34314255 nonsense probably null
R5851:H2-Eb1 UTSW 17 34309771 missense probably benign 0.13
R6951:H2-Eb1 UTSW 17 34309857 nonsense probably null
R7387:H2-Eb1 UTSW 17 34314233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGAGCCTGCCAGTGACATAAC -3'
(R):5'- GGCCAATGGCATCCTGAGAACAAAG -3'

Sequencing Primer
(F):5'- GGGACATATAGTCATAGCTCTGCC -3'
(R):5'- GCCATGGCTTTTCCCTGAAA -3'
Posted On2015-02-04