Incidental Mutation 'R3124:Tas2r129'
List |< first << previous [record 29 of 38] next >> last >|
ID264192
Institutional Source Beutler Lab
Gene Symbol Tas2r129
Ensembl Gene ENSMUSG00000063762
Gene Nametaste receptor, type 2, member 129
SynonymsTas2r29, mt2r60, T2R29, mGR29
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132951102-132952066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132951448 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000067640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070991]
Predicted Effect probably damaging
Transcript: ENSMUST00000070991
AA Change: N116S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067640
Gene: ENSMUSG00000063762
AA Change: N116S

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-74 PFAM
Meta Mutation Damage Score 0.2798 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Tas2r129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Tas2r129 APN 6 132951394 nonsense probably null
R0389:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0443:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951943 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951944 missense probably benign 0.31
R0576:Tas2r129 UTSW 6 132951534 missense probably benign 0.38
R1253:Tas2r129 UTSW 6 132952036 missense probably benign 0.11
R4493:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4494:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4591:Tas2r129 UTSW 6 132951611 missense probably benign 0.10
R6156:Tas2r129 UTSW 6 132951492 missense probably benign 0.31
R6495:Tas2r129 UTSW 6 132951165 missense probably benign 0.00
R7600:Tas2r129 UTSW 6 132951174 nonsense probably null
R7608:Tas2r129 UTSW 6 132951193 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGCCTTGGCTTTCTCCAG -3'
(R):5'- TCTTGTAATGTCTCCACAGGG -3'

Sequencing Primer
(F):5'- AGCCTTGGCTTTCTCCAGAATCTAC -3'
(R):5'- AGGGTATAGATGTGAAAATACAGTTG -3'
Posted On2015-02-05