Incidental Mutation 'R2217:Psma1'
List |< first << previous [record 32 of 46] next >> last >|
ID241210
Institutional Source Beutler Lab
Gene Symbol Psma1
Ensembl Gene ENSMUSG00000030751
Gene Nameproteasome (prosome, macropain) subunit, alpha type 1
SynonymsC2, HC2, Pros-30
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location114264606-114276118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114264938 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 227 (E227K)
Ref Sequence ENSEMBL: ENSMUSP00000147815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033008] [ENSMUST00000135570]
Predicted Effect unknown
Transcript: ENSMUST00000033008
AA Change: E252K
SMART Domains Protein: ENSMUSP00000033008
Gene: ENSMUSG00000030751
AA Change: E252K

DomainStartEndE-ValueType
Proteasome_A_N 6 28 6.32e-8 SMART
Pfam:Proteasome 29 215 3.2e-54 PFAM
low complexity region 243 262 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135570
AA Change: E227K
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Psma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03001:Psma1 APN 7 114266439 missense probably benign 0.01
tempt UTSW 7 114274448 missense probably damaging 1.00
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R0046:Psma1 UTSW 7 114267205 splice site probably benign
R2062:Psma1 UTSW 7 114269766 missense possibly damaging 0.95
R4633:Psma1 UTSW 7 114271134 missense probably damaging 1.00
R5585:Psma1 UTSW 7 114274067 missense probably damaging 1.00
R6357:Psma1 UTSW 7 114274367 intron probably null
R7137:Psma1 UTSW 7 114274448 missense probably damaging 1.00
R7592:Psma1 UTSW 7 114269726 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTAGAGAAAACTTACATCTGGAC -3'
(R):5'- AAGGTGCTGGCTGTGTTCTAAAC -3'

Sequencing Primer
(F):5'- TGGACTGATTTCTAAAACATACCACC -3'
(R):5'- CAGTGGAATTGTCTTTAAGTTGACAG -3'
Posted On2014-10-15