Incidental Mutation 'R3856:Idi1'
List |< first << previous [record 33 of 53] next >> last >|
ID276177
Institutional Source Beutler Lab
Gene Symbol Idi1
Ensembl Gene ENSMUSG00000058258
Gene Nameisopentenyl-diphosphate delta isomerase
Synonyms
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8885501-8892451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8885932 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 25 (A25S)
Ref Sequence ENSEMBL: ENSMUSP00000132780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169314]
Predicted Effect probably benign
Transcript: ENSMUST00000169314
AA Change: A25S

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132780
Gene: ENSMUSG00000058258
AA Change: A25S

DomainStartEndE-ValueType
Pfam:NUDIX 106 256 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176851
Predicted Effect probably benign
Transcript: ENSMUST00000177397
Predicted Effect probably benign
Transcript: ENSMUST00000177400
Predicted Effect probably benign
Transcript: ENSMUST00000177447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221551
Meta Mutation Damage Score 0.2167 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Idi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Idi1 APN 13 8890379 missense probably benign 0.12
R0304:Idi1 UTSW 13 8890357 missense probably damaging 1.00
R1535:Idi1 UTSW 13 8886909 splice site probably benign
R1739:Idi1 UTSW 13 8890411 missense probably benign 0.05
R3854:Idi1 UTSW 13 8885932 missense probably benign 0.05
R3855:Idi1 UTSW 13 8885932 missense probably benign 0.05
R4463:Idi1 UTSW 13 8887472 splice site probably benign
R5049:Idi1 UTSW 13 8888042 missense probably damaging 1.00
R5081:Idi1 UTSW 13 8887927 nonsense probably null
R6062:Idi1 UTSW 13 8887505 missense probably damaging 1.00
R6082:Idi1 UTSW 13 8890470 nonsense probably null
R7261:Idi1 UTSW 13 8886895 missense probably benign 0.31
Z1177:Idi1 UTSW 13 8888019 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTTTCAGAGCCACACGCAG -3'
(R):5'- TTTCCATGGACAACCCTGAGAAC -3'

Sequencing Primer
(F):5'- CACACGCAGGGCAAGTG -3'
(R):5'- AACGCTTTCCAGGACCAGG -3'
Posted On2015-04-06