Incidental Mutation 'R8003:Olfr1164'
List |< first << previous [record 34 of 52] next >> last >|
ID616439
Institutional Source Beutler Lab
Gene Symbol Olfr1164
Ensembl Gene ENSMUSG00000075136
Gene Nameolfactory receptor 1164
SynonymsMOR174-11, GA_x6K02T2Q125-49585842-49584862
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R8003 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88092855-88093966 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88093245 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 230 (Y230*)
Ref Sequence ENSEMBL: ENSMUSP00000097422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099834]
Predicted Effect probably null
Transcript: ENSMUST00000099834
AA Change: Y230*
SMART Domains Protein: ENSMUSP00000097422
Gene: ENSMUSG00000075136
AA Change: Y230*

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 3.8e-47 PFAM
Pfam:7tm_1 53 302 2.9e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A G 14: 55,781,635 V155A probably benign Het
Arfgef2 A G 2: 166,853,288 Y527C probably damaging Het
B020004J07Rik T C 4: 101,835,933 K290R probably benign Het
Brca1 C T 11: 101,524,477 G944R probably benign Het
C2cd2 A G 16: 97,886,086 probably null Het
Cass4 T C 2: 172,427,959 F654L unknown Het
Ccdc178 A T 18: 21,844,887 probably null Het
Cct4 T C 11: 22,996,040 probably null Het
Cish T C 9: 107,297,028 V5A possibly damaging Het
Col5a1 G A 2: 27,958,328 probably benign Het
Col6a3 G T 1: 90,775,733 N3037K unknown Het
Csmd2 T A 4: 128,539,187 C3012* probably null Het
Dclk2 T C 3: 86,793,301 probably null Het
Dhx38 A T 8: 109,556,140 D631E probably damaging Het
Eif2ak2 C A 17: 78,876,223 A66S probably damaging Het
Ephx2 A G 14: 66,124,333 probably null Het
Fbxw10 T G 11: 62,857,761 C405G possibly damaging Het
Galnt13 G T 2: 55,060,485 G393* probably null Het
Gm5591 G T 7: 38,519,759 H563Q probably damaging Het
Gtf3c5 A G 2: 28,569,361 I394T probably benign Het
Hectd4 G A 5: 121,339,518 A2835T possibly damaging Het
Herc2 A G 7: 56,168,904 D2781G possibly damaging Het
Kmt2b G T 7: 30,569,377 H2642Q probably damaging Het
Lars A T 18: 42,221,619 D754E probably damaging Het
Lrpprc A C 17: 84,752,317 S690A probably benign Het
Map3k6 A G 4: 133,248,882 T805A probably benign Het
Mthfd1l T G 10: 3,984,147 S160A probably benign Het
Mtmr6 G A 14: 60,282,095 probably null Het
Mybpc2 A T 7: 44,509,064 M698K probably damaging Het
Myh8 T A 11: 67,299,760 L1304M probably damaging Het
Mylip T A 13: 45,404,471 V117E probably benign Het
Npc1l1 T C 11: 6,215,129 Q1061R probably benign Het
Olfr1148 A G 2: 87,833,737 R233G probably benign Het
Pkd2l2 G A 18: 34,428,179 M413I probably damaging Het
Plch2 C T 4: 155,054,523 G19D unknown Het
Psg22 A C 7: 18,724,425 Y347S probably damaging Het
Ptpre C A 7: 135,669,036 Q314K probably damaging Het
Rgs6 T C 12: 82,985,370 S54P probably damaging Het
Sbds C A 5: 130,250,885 V130F possibly damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc24a2 A T 4: 87,176,315 D322E probably benign Het
Slc45a4 G T 15: 73,585,313 Y585* probably null Het
Slc7a4 A C 16: 17,574,451 V373G possibly damaging Het
Sulf1 G A 1: 12,838,601 V613M probably damaging Het
Syt1 T C 10: 108,636,573 D150G probably damaging Het
Tnpo3 C A 6: 29,551,901 V888F probably benign Het
Trim9 T C 12: 70,346,834 H112R probably benign Het
Vmn2r80 T C 10: 79,148,877 I21T probably benign Het
Wdr41 C A 13: 95,013,146 A286E possibly damaging Het
Wnt8b T A 19: 44,511,957 C328S probably damaging Het
Ybx3 A T 6: 131,368,437 Y324* probably null Het
Zmynd15 T A 11: 70,460,941 H124Q probably benign Het
Other mutations in Olfr1164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Olfr1164 APN 2 88093016 missense possibly damaging 0.48
IGL02894:Olfr1164 APN 2 88093763 missense possibly damaging 0.79
IGL02977:Olfr1164 APN 2 88093571 missense probably benign
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0234:Olfr1164 UTSW 2 88093022 nonsense probably null
R0480:Olfr1164 UTSW 2 88093628 missense probably benign
R0644:Olfr1164 UTSW 2 88093289 missense probably benign 0.02
R1479:Olfr1164 UTSW 2 88093286 missense probably benign 0.05
R2047:Olfr1164 UTSW 2 88093893 missense probably benign 0.01
R2311:Olfr1164 UTSW 2 88093834 missense probably benign 0.00
R2973:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R3683:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R3685:Olfr1164 UTSW 2 88093259 missense probably damaging 1.00
R4258:Olfr1164 UTSW 2 88093018 missense probably damaging 1.00
R4811:Olfr1164 UTSW 2 88093532 missense probably benign 0.08
R4970:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5112:Olfr1164 UTSW 2 88093009 missense probably damaging 1.00
R5258:Olfr1164 UTSW 2 88093418 missense probably benign 0.22
R5884:Olfr1164 UTSW 2 88093796 missense probably damaging 1.00
R6329:Olfr1164 UTSW 2 88093664 missense probably damaging 1.00
R6597:Olfr1164 UTSW 2 88093069 missense probably damaging 1.00
R7018:Olfr1164 UTSW 2 88093256 missense probably benign 0.00
R7055:Olfr1164 UTSW 2 88093701 missense probably damaging 1.00
R7314:Olfr1164 UTSW 2 88093114 missense probably benign 0.00
R7350:Olfr1164 UTSW 2 88093198 missense probably benign 0.01
R7527:Olfr1164 UTSW 2 88093610 missense probably damaging 1.00
Z1176:Olfr1164 UTSW 2 88093334 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATAGGGATGACCATGCTGTG -3'
(R):5'- GGCTGGGATATTTTCCTCAACTC -3'

Sequencing Primer
(F):5'- TGGAACACAGTGGCTACTTTCAC -3'
(R):5'- AACTCTCACATATATTCTTTTGCAGC -3'
Posted On2020-01-23