Incidental Mutation 'R1065:Olfr1094'
List |< first << previous [record 36 of 36]
ID85951
Institutional Source Beutler Lab
Gene Symbol Olfr1094
Ensembl Gene ENSMUSG00000044213
Gene Nameolfactory receptor 1094
SynonymsGA_x6K02T2Q125-48321457-48322449, MOR179-7
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86824663-86830282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86829544 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 264 (H264R)
Ref Sequence ENSEMBL: ENSMUSP00000148902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105211] [ENSMUST00000217509]
Predicted Effect probably damaging
Transcript: ENSMUST00000105211
AA Change: H264R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100846
Gene: ENSMUSG00000044213
AA Change: H264R

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 4.6e-52 PFAM
Pfam:7tm_1 53 316 3.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217509
AA Change: H264R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.3458 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Olfr1094
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Olfr1094 APN 2 86829368 missense probably benign
IGL03053:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL03168:Olfr1094 APN 2 86829263 missense possibly damaging 0.93
IGL02799:Olfr1094 UTSW 2 86828956 missense probably damaging 0.99
R0511:Olfr1094 UTSW 2 86829606 missense probably benign 0.02
R0944:Olfr1094 UTSW 2 86828937 missense probably benign 0.01
R1476:Olfr1094 UTSW 2 86829198 missense probably benign 0.31
R1807:Olfr1094 UTSW 2 86829101 missense probably benign 0.03
R2865:Olfr1094 UTSW 2 86828854 missense probably benign 0.21
R2915:Olfr1094 UTSW 2 86829226 missense probably benign 0.02
R3055:Olfr1094 UTSW 2 86829127 missense possibly damaging 0.94
R3104:Olfr1094 UTSW 2 86829691 missense probably benign 0.03
R4862:Olfr1094 UTSW 2 86829532 missense probably damaging 1.00
R4874:Olfr1094 UTSW 2 86829254 missense probably damaging 0.98
R5505:Olfr1094 UTSW 2 86829501 missense possibly damaging 0.88
R5507:Olfr1094 UTSW 2 86829317 missense probably damaging 1.00
R6318:Olfr1094 UTSW 2 86829654 missense possibly damaging 0.73
R6538:Olfr1094 UTSW 2 86829525 missense possibly damaging 0.55
R8058:Olfr1094 UTSW 2 86829708 missense probably benign 0.01
R8285:Olfr1094 UTSW 2 86829099 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCAGCAATGGCTTATGATCGC -3'
(R):5'- ACCTGTGCTTGAATCCATCCATAGC -3'

Sequencing Primer
(F):5'- CTGTGCATCCAATGAGATTAGGC -3'
(R):5'- AGCTCTAACATTTTAGAACATGGC -3'
Posted On2013-11-18