Incidental Mutation 'R1065:Snx9'
List |< first << previous [record 36 of 36]
ID85978
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.763) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 5902361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000002436
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5459:Snx9 UTSW 17 5920638 missense probably damaging 0.99
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
R7873:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCTTAATGCCGACTGCAAAGCCTG -3'
(R):5'- TTCTTACATTGCACGCACGCAC -3'

Sequencing Primer
(F):5'- TGCAAAGCCTGTGCTCTAAAG -3'
(R):5'- acacacacacacacacacac -3'
Posted On2013-11-18