Incidental Mutation 'R3856:Pbp2'
List |< first << previous [record 36 of 53] next >> last >|
ID276158
Institutional Source Beutler Lab
Gene Symbol Pbp2
Ensembl Gene ENSMUSG00000047104
Gene Namephosphatidylethanolamine binding protein 2
Synonyms1700023A18Rik, Pebp-2, Pebp2
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location135309127-135310405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135310145 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 68 (L68P)
Ref Sequence ENSEMBL: ENSMUSP00000098414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050471]
Predicted Effect probably benign
Transcript: ENSMUST00000050471
AA Change: L68P

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098414
Gene: ENSMUSG00000047104
AA Change: L68P

DomainStartEndE-ValueType
Pfam:PBP 27 169 4.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203686
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Vmn1r189 A T 13: 22,102,269 F133I possibly damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Pbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01728:Pbp2 APN 6 135310075 missense probably damaging 1.00
IGL02120:Pbp2 APN 6 135309818 missense probably damaging 1.00
IGL02582:Pbp2 APN 6 135310149 missense probably benign
R5476:Pbp2 UTSW 6 135309924 missense probably benign 0.21
R5802:Pbp2 UTSW 6 135309876 missense possibly damaging 0.84
R7316:Pbp2 UTSW 6 135309832 missense probably damaging 0.98
R8184:Pbp2 UTSW 6 135310262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACATCTCAGTGGCTTGTC -3'
(R):5'- CCATGCCTACAGACATGAGC -3'

Sequencing Primer
(F):5'- GGCTTGTCCTGCTGGTACAC -3'
(R):5'- CATGAGCATGTGGACCGG -3'
Posted On2015-04-06