Incidental Mutation 'R6844:Arhgap18'
List |< first << previous [record 41 of 41]
ID534676
Institutional Source Beutler Lab
Gene Symbol Arhgap18
Ensembl Gene ENSMUSG00000039031
Gene NameRho GTPase activating protein 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6844 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location26753421-26918648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26772686 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 35 (A35T)
Ref Sequence ENSEMBL: ENSMUSP00000044834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039557] [ENSMUST00000176060]
Predicted Effect probably benign
Transcript: ENSMUST00000039557
AA Change: A35T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044834
Gene: ENSMUSG00000039031
AA Change: A35T

DomainStartEndE-ValueType
low complexity region 100 114 N/A INTRINSIC
RhoGAP 340 520 8.99e-42 SMART
coiled coil region 535 557 N/A INTRINSIC
Blast:RhoGAP 572 613 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176060
SMART Domains Protein: ENSMUSP00000135030
Gene: ENSMUSG00000039031

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP18 belongs to a family of Rho (see MIM 165390) GTPase-activating proteins that modulate cell signaling (Potkin et al., 2009 [PubMed 19065146]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A G 2: 20,881,305 S354P probably benign Het
Casq2 A T 3: 102,110,262 H86L possibly damaging Het
Ccdc188 G A 16: 18,218,210 G83E probably damaging Het
Cd22 G T 7: 30,873,431 probably null Het
Cyp2b13 T A 7: 26,081,697 I178N probably damaging Het
Cyp4a31 T A 4: 115,563,792 C26S probably null Het
Eif3h T C 15: 51,865,333 D42G possibly damaging Het
Elovl4 T A 9: 83,790,111 I52L probably benign Het
Fgfbp3 C A 19: 36,918,880 A113S possibly damaging Het
Fsip2 A T 2: 82,983,625 K3429N possibly damaging Het
Gemin5 T C 11: 58,163,904 D224G probably benign Het
Gm3415 T C 5: 146,558,001 I158T probably benign Het
Gpr22 C A 12: 31,709,952 R20L probably benign Het
Htr1a A G 13: 105,444,947 K232E possibly damaging Het
Itgax T A 7: 128,147,934 probably null Het
Jag2 T C 12: 112,916,714 Y310C probably damaging Het
Lce1j A G 3: 92,789,349 S41P unknown Het
Mllt10 A G 2: 18,159,483 I197V probably benign Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mybpc1 T A 10: 88,536,381 I796F possibly damaging Het
Nr2c1 T A 10: 94,171,167 L289* probably null Het
Omp T A 7: 98,145,076 M115L probably benign Het
Pdcd1 C T 1: 94,039,381 R264H probably benign Het
Plxna2 T C 1: 194,793,828 F1119L probably benign Het
Ralyl A G 3: 13,776,878 T25A probably damaging Het
Rapgef4 A G 2: 72,234,626 T656A probably damaging Het
Ripor3 C T 2: 167,993,333 probably null Het
Samd8 T C 14: 21,775,137 S54P probably damaging Het
Serpinb9g A T 13: 33,486,633 I35F probably damaging Het
Shisa8 T C 15: 82,212,109 S102G probably damaging Het
Slc4a1ap T A 5: 31,527,478 S153T probably damaging Het
Slc4a4 T A 5: 89,228,972 D1028E probably damaging Het
Slc6a13 T A 6: 121,325,053 I198N probably damaging Het
Sst C T 16: 23,889,842 D80N probably benign Het
Synj2 A G 17: 5,975,806 K47E probably damaging Het
Tal1 C T 4: 115,063,267 P46L probably benign Het
Top2b A T 14: 16,429,383 N1541I possibly damaging Het
Vps13b T A 15: 35,877,590 N2903K probably benign Het
Zfp949 A G 9: 88,569,411 T345A possibly damaging Het
Zmat3 A G 3: 32,341,495 Y288H probably damaging Het
Other mutations in Arhgap18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Arhgap18 APN 10 26880748 missense possibly damaging 0.75
IGL02393:Arhgap18 APN 10 26877183 missense probably benign 0.07
IGL03368:Arhgap18 APN 10 26772693 missense possibly damaging 0.60
Half_pint UTSW 10 26772698 critical splice donor site probably null
R0698:Arhgap18 UTSW 10 26912629 missense probably damaging 1.00
R1456:Arhgap18 UTSW 10 26916440 missense probably benign 0.29
R1532:Arhgap18 UTSW 10 26860722 missense possibly damaging 0.69
R1768:Arhgap18 UTSW 10 26887861 missense probably damaging 1.00
R1768:Arhgap18 UTSW 10 26887862 missense probably damaging 1.00
R1793:Arhgap18 UTSW 10 26860736 unclassified probably benign
R1867:Arhgap18 UTSW 10 26846030 missense probably damaging 0.99
R2020:Arhgap18 UTSW 10 26854904 missense probably benign
R2049:Arhgap18 UTSW 10 26849942 missense probably benign 0.00
R2056:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2058:Arhgap18 UTSW 10 26854908 missense probably benign 0.03
R2986:Arhgap18 UTSW 10 26854907 missense probably benign 0.00
R3027:Arhgap18 UTSW 10 26846096 missense probably benign
R5103:Arhgap18 UTSW 10 26869982 missense probably damaging 1.00
R5468:Arhgap18 UTSW 10 26912671 missense probably damaging 0.99
R5532:Arhgap18 UTSW 10 26846108 missense possibly damaging 0.56
R5710:Arhgap18 UTSW 10 26860733 unclassified probably null
R6019:Arhgap18 UTSW 10 26860650 missense probably damaging 0.98
R6190:Arhgap18 UTSW 10 26846035 start codon destroyed probably null 0.22
R6346:Arhgap18 UTSW 10 26846065 missense probably damaging 1.00
R6438:Arhgap18 UTSW 10 26772698 critical splice donor site probably null
R6572:Arhgap18 UTSW 10 26846416 intron probably null
R6799:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7051:Arhgap18 UTSW 10 26849921 missense possibly damaging 0.57
R7084:Arhgap18 UTSW 10 26872738 missense possibly damaging 0.77
R7727:Arhgap18 UTSW 10 26870011 missense possibly damaging 0.83
R8046:Arhgap18 UTSW 10 26887857 missense probably damaging 0.98
R8252:Arhgap18 UTSW 10 26854936 missense probably benign 0.00
R8392:Arhgap18 UTSW 10 26845940 missense probably benign 0.38
Z1088:Arhgap18 UTSW 10 26850004 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TCAGGCGAGACAGGAACTTC -3'
(R):5'- CACCTGCTAAGCAACTGGTC -3'

Sequencing Primer
(F):5'- GAACTTCATTCCCCTCTGTGTCAG -3'
(R):5'- TAACCAGAAGGGCTCTTGC -3'
Posted On2018-09-12