Incidental Mutation 'R3797:Basp1'
List |< first << previous [record 5 of 43] next >> last >|
ID272813
Institutional Source Beutler Lab
Gene Symbol Basp1
Ensembl Gene ENSMUSG00000045763
Gene Namebrain abundant, membrane attached signal protein 1
SynonymsCkap3, CAP-23, 2610024P12Rik, CAP23
MMRRC Submission 040758-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3797 (G1)
Quality Score179
Status Validated
Chromosome15
Chromosomal Location25363277-25413764 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 25364312 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058845] [ENSMUST00000228597]
Predicted Effect unknown
Transcript: ENSMUST00000058845
AA Change: A200S
SMART Domains Protein: ENSMUSP00000053943
Gene: ENSMUSG00000045763
AA Change: A200S

DomainStartEndE-ValueType
Pfam:BASP1 2 226 5.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228597
Meta Mutation Damage Score 0.1509 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, hyperactivity, decreased body weight, and defects in neurite axon outgrowth, Schwann cell morphology, and brain ventricle size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 T C 5: 30,196,823 I736V possibly damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
B4galt1 G A 4: 40,807,258 T376I probably benign Het
Capn5 C T 7: 98,125,829 G535R probably null Het
Ccdc170 G A 10: 4,560,920 V660I possibly damaging Het
Cdc73 A T 1: 143,677,723 D215E probably benign Het
Clec14a G A 12: 58,267,909 A309V probably benign Het
Clns1a G A 7: 97,696,835 G36R probably benign Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Csmd2 C T 4: 128,517,595 P2469S probably benign Het
Dsp T A 13: 38,177,284 probably null Het
Eif3d A G 15: 77,968,569 F4S probably damaging Het
Ephb1 T C 9: 101,971,267 T611A probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fgfr1 G A 8: 25,572,437 D663N probably damaging Het
Gm5592 G A 7: 41,157,835 probably benign Het
Itgb8 T C 12: 119,163,469 I683M possibly damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Limch1 A G 5: 66,969,079 T8A probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Ltbp1 A G 17: 75,362,630 Q1455R probably damaging Het
Marc2 T C 1: 184,841,308 E131G possibly damaging Het
Olfr620 C T 7: 103,611,447 R302Q probably benign Het
Pak7 T C 2: 136,100,826 I465V probably benign Het
Pcdhgb8 T C 18: 37,762,675 I266T probably benign Het
Pde4d T C 13: 109,632,897 S40P probably benign Het
Phrf1 C T 7: 141,259,918 R243* probably null Het
Polk A T 13: 96,486,982 probably benign Het
Ppl T C 16: 5,104,550 probably benign Het
Rab11fip3 A G 17: 26,068,526 C218R possibly damaging Het
Setd2 T C 9: 110,549,571 V818A probably benign Het
Skida1 C A 2: 18,045,897 E815* probably null Het
Slc35g3 A G 11: 69,760,917 F103L probably benign Het
Svil T A 18: 5,060,534 C802S probably benign Het
Trim7 A G 11: 48,845,670 probably null Het
Ugt3a1 G A 15: 9,310,641 W336* probably null Het
Vmn2r72 T C 7: 85,738,077 S760G probably benign Het
Vps13a T C 19: 16,745,947 probably null Het
Wdfy4 A T 14: 33,140,645 I590N probably damaging Het
Xdh T C 17: 73,907,658 E764G probably damaging Het
Xpnpep1 A T 19: 53,006,342 V285D probably benign Het
Zfp934 T C 13: 62,517,888 K313R probably benign Het
Other mutations in Basp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Basp1 APN 15 25364867 missense unknown
R0573:Basp1 UTSW 15 25364862 missense unknown
R3796:Basp1 UTSW 15 25364312 unclassified probably benign
R3798:Basp1 UTSW 15 25364312 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCAATACATATCCTCACTTC -3'
(R):5'- GGGCTACAATGTGAACGACG -3'

Sequencing Primer
(F):5'- TCCTCACTTCCAATTTGAAACAAG -3'
(R):5'- ACGCCACCGAGGTCAAG -3'
Posted On2015-03-25