Incidental Mutation 'R0595:Dnajb9'
List |< first << previous [record 51 of 51]
ID55081
Institutional Source Beutler Lab
Gene Symbol Dnajb9
Ensembl Gene ENSMUSG00000014905
Gene NameDnaJ heat shock protein family (Hsp40) member B9
SynonymsmDj7, Mdg1, microvascular endothelial differentiation gene, ERdj4
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R0595 (G1)
Quality Score222
Status Validated
Chromosome12
Chromosomal Location44205559-44210326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44208284 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000152011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015049] [ENSMUST00000220421]
Predicted Effect probably benign
Transcript: ENSMUST00000015049
AA Change: V7A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015049
Gene: ENSMUSG00000014905
AA Change: V7A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
DnaJ 25 82 2.55e-29 SMART
low complexity region 111 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177238
Predicted Effect probably benign
Transcript: ENSMUST00000220421
AA Change: V7A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele show perinatal death, reduced birth size and liver glycogen levels, and hypoglycemia. Surviving adults show elevated ER stress in MEFs, lung, kidney, salivary gland and in pancreas, associated with beta cell loss, hypoinsulinemia, and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Dnajb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Dnajb9 APN 12 44207086 missense possibly damaging 0.72
IGL02093:Dnajb9 APN 12 44207204 missense probably damaging 0.99
IGL03383:Dnajb9 APN 12 44208313 splice site probably benign
R0355:Dnajb9 UTSW 12 44207204 missense probably damaging 0.98
R2191:Dnajb9 UTSW 12 44207073 missense probably benign
R4192:Dnajb9 UTSW 12 44207077 missense probably benign 0.01
R7574:Dnajb9 UTSW 12 44207386 missense probably damaging 1.00
X0067:Dnajb9 UTSW 12 44207333 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTGAATTTTGCTTCAGCATCAGGGC -3'
(R):5'- TGTATCACAGGCAGACAAGTTCACC -3'

Sequencing Primer
(F):5'- CAGCATCAGGGCTTTTATTTTTGTC -3'
(R):5'- CTGTCTCAACACCAGAGCTT -3'
Posted On2013-07-11