Incidental Mutation 'R8676:0610037L13Rik'
ID 661371
Institutional Source Beutler Lab
Gene Symbol 0610037L13Rik
Ensembl Gene ENSMUSG00000028608
Gene Name RIKEN cDNA 0610037L13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 107889813-107899384 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107895599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 152 (N152D)
Ref Sequence ENSEMBL: ENSMUSP00000113991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106726] [ENSMUST00000106727] [ENSMUST00000119394] [ENSMUST00000120473] [ENSMUST00000125107] [ENSMUST00000128474] [ENSMUST00000132417] [ENSMUST00000134254] [ENSMUST00000135454]
AlphaFold Q8BHG2
Predicted Effect probably benign
Transcript: ENSMUST00000106726
SMART Domains Protein: ENSMUSP00000102337
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 114 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106727
SMART Domains Protein: ENSMUSP00000102338
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 154 1.2e-62 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119394
AA Change: N152D
SMART Domains Protein: ENSMUSP00000113991
Gene: ENSMUSG00000028608
AA Change: N152D

DomainStartEndE-ValueType
Pfam:DUF866 1 146 8.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120473
SMART Domains Protein: ENSMUSP00000113866
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 138 2.7e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125107
SMART Domains Protein: ENSMUSP00000119565
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 40 194 2.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128474
SMART Domains Protein: ENSMUSP00000115797
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 2 66 4.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132417
SMART Domains Protein: ENSMUSP00000117717
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 37 98 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134254
SMART Domains Protein: ENSMUSP00000119309
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 46 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135454
SMART Domains Protein: ENSMUSP00000114234
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 1 160 1.7e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in 0610037L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:0610037L13Rik APN 4 107894868 splice site probably benign
horribilis UTSW 4 107891998 missense probably damaging 1.00
R0787:0610037L13Rik UTSW 4 107890129 missense probably damaging 1.00
R3500:0610037L13Rik UTSW 4 107891513 missense probably damaging 1.00
R4778:0610037L13Rik UTSW 4 107891998 missense probably damaging 1.00
R5940:0610037L13Rik UTSW 4 107893288 intron probably benign
R6644:0610037L13Rik UTSW 4 107894922 missense probably damaging 0.99
R7164:0610037L13Rik UTSW 4 107894890 missense not run
R7535:0610037L13Rik UTSW 4 107894900 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GAAGTCTTTACACAGAAATCACTACA -3'
(R):5'- TGCATAACCATGGGATCGCC -3'

Sequencing Primer
(F):5'- GCCCACATGTAGTTAAACATTCG -3'
(R):5'- CACTTAAGTGCGATGACGGTCTC -3'
Posted On 2021-03-08