Incidental Mutation 'R1393:Cd300ld2'
List |< first << previous [record 9 of 26] next >> last >|
ID162707
Institutional Source Beutler Lab
Gene Symbol Cd300ld2
Ensembl Gene ENSMUSG00000089753
Gene NameCD300 molecule like family member D2
SynonymsGm11709
MMRRC Submission 039455-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1393 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115010335-115016193 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 115012578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092463] [ENSMUST00000106578]
Predicted Effect probably benign
Transcript: ENSMUST00000092463
SMART Domains Protein: ENSMUSP00000090120
Gene: ENSMUSG00000089753

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000106578
AA Change: P147L
SMART Domains Protein: ENSMUSP00000102188
Gene: ENSMUSG00000089753
AA Change: P147L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 25 124 2.11e-2 SMART
low complexity region 131 201 N/A INTRINSIC
low complexity region 202 222 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 A G 16: 20,560,430 N682S probably benign Het
Acta2 G A 19: 34,241,792 R337C probably damaging Het
Anxa5 G A 3: 36,453,509 T194I probably damaging Het
Atf1 A G 15: 100,232,766 T6A possibly damaging Het
Atg4d T A 9: 21,270,833 Y317N probably damaging Het
Bcl6 A G 16: 23,977,566 V37A probably damaging Het
Bsn T C 9: 108,110,517 probably benign Het
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Chad A T 11: 94,565,314 M73L probably benign Het
Copz1 A G 15: 103,294,744 N95S probably benign Het
Cwf19l2 T C 9: 3,456,818 V717A probably benign Het
Dock3 C T 9: 106,911,349 G140R probably damaging Het
Gm14226 A T 2: 155,024,191 S23C probably damaging Het
Gria2 T C 3: 80,707,098 E545G probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr811 A G 10: 129,801,932 F198L probably benign Het
Patj G A 4: 98,424,411 V329I probably benign Het
Ptcd3 T A 6: 71,889,621 T404S probably benign Het
Rasa1 A G 13: 85,223,522 C867R probably damaging Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Serpina12 T C 12: 104,037,750 I208V possibly damaging Het
Spock1 A T 13: 57,907,454 L45Q probably damaging Het
Stat3 A T 11: 100,888,765 probably null Het
Zfp810 T C 9: 22,280,514 D90G probably benign Het
Other mutations in Cd300ld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Cd300ld2 APN 11 115012297 missense probably benign 0.23
IGL01450:Cd300ld2 APN 11 115012543 unclassified probably benign
IGL01452:Cd300ld2 APN 11 115012602 unclassified probably benign
IGL02086:Cd300ld2 APN 11 115012558 unclassified probably benign
IGL02111:Cd300ld2 APN 11 115012393 unclassified probably benign
IGL02505:Cd300ld2 APN 11 115013687 missense probably benign 0.11
IGL02517:Cd300ld2 APN 11 115010423 missense possibly damaging 0.53
IGL02836:Cd300ld2 APN 11 115013750 missense probably benign 0.07
IGL03081:Cd300ld2 APN 11 115012542 unclassified probably benign
PIT4486001:Cd300ld2 UTSW 11 115012431 small deletion probably benign
R0579:Cd300ld2 UTSW 11 115012299 missense probably benign 0.23
R1065:Cd300ld2 UTSW 11 115013760 missense probably damaging 1.00
R1481:Cd300ld2 UTSW 11 115012633 missense probably benign 0.36
R1583:Cd300ld2 UTSW 11 115013777 missense probably benign 0.06
R1755:Cd300ld2 UTSW 11 115013775 missense probably benign 0.01
R1865:Cd300ld2 UTSW 11 115012618 unclassified probably benign
R4018:Cd300ld2 UTSW 11 115012504 unclassified probably benign
R5516:Cd300ld2 UTSW 11 115012444 unclassified probably benign
R6065:Cd300ld2 UTSW 11 115012602 unclassified probably benign
R6927:Cd300ld2 UTSW 11 115013793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAATGTTCTCTGTGCCAATGC -3'
(R):5'- TCCTGATGGTGCCTGGAAATCGAG -3'

Sequencing Primer
(F):5'- GATGGCAGAACTGTGGATGG -3'
(R):5'- CGAGCTCCTTAATTCCTAGGGAA -3'
Posted On2014-03-17