Incidental Mutation 'R1220:Olfr495'
ID100000
Institutional Source Beutler Lab
Gene Symbol Olfr495
Ensembl Gene ENSMUSG00000110253
Gene Nameolfactory receptor 495
SynonymsMOR204-37, GA_x6K02T2PBJ9-10725148-10726140
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108393167-108397513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108395332 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 71 (S71T)
Ref Sequence ENSEMBL: ENSMUSP00000150689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210990] [ENSMUST00000215215]
Predicted Effect probably benign
Transcript: ENSMUST00000071505
AA Change: S71T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000071440
Gene: ENSMUSG00000094104
AA Change: S71T

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3.6e-51 PFAM
Pfam:7tm_1 44 293 2.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210990
AA Change: S71T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215215
AA Change: S71T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Olfr495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Olfr495 APN 7 108395245 missense probably benign 0.31
IGL02430:Olfr495 APN 7 108395722 missense probably benign 0.01
IGL02511:Olfr495 APN 7 108396058 missense probably benign 0.06
IGL02932:Olfr495 APN 7 108395513 missense probably benign 0.03
IGL03222:Olfr495 APN 7 108395186 missense possibly damaging 0.77
FR4340:Olfr495 UTSW 7 108395893 missense probably benign
FR4340:Olfr495 UTSW 7 108395898 missense probably benign
FR4342:Olfr495 UTSW 7 108395893 missense probably benign
FR4342:Olfr495 UTSW 7 108395898 missense probably benign
R0141:Olfr495 UTSW 7 108395368 missense probably benign 0.06
R0600:Olfr495 UTSW 7 108395231 missense probably damaging 0.98
R0635:Olfr495 UTSW 7 108395764 missense probably benign 0.01
R0685:Olfr495 UTSW 7 108395263 missense possibly damaging 0.67
R1398:Olfr495 UTSW 7 108395501 missense probably damaging 0.98
R1501:Olfr495 UTSW 7 108396082 missense probably benign 0.00
R1990:Olfr495 UTSW 7 108395834 missense probably benign 0.00
R2091:Olfr495 UTSW 7 108395861 missense probably damaging 1.00
R2473:Olfr495 UTSW 7 108395504 missense probably damaging 1.00
R3120:Olfr495 UTSW 7 108395723 missense possibly damaging 0.67
R4771:Olfr495 UTSW 7 108396022 nonsense probably null
R5240:Olfr495 UTSW 7 108395702 missense probably damaging 0.99
R5510:Olfr495 UTSW 7 108395125 missense probably benign 0.01
R5703:Olfr495 UTSW 7 108395500 missense probably benign 0.23
R6102:Olfr495 UTSW 7 108395284 missense probably damaging 0.99
R6110:Olfr495 UTSW 7 108395828 missense possibly damaging 0.93
R6782:Olfr495 UTSW 7 108395537 missense probably damaging 1.00
R7062:Olfr495 UTSW 7 108395830 nonsense probably null
R7783:Olfr495 UTSW 7 108396089 missense probably benign 0.15
R8386:Olfr495 UTSW 7 108395348 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGCAACTACGTGTCTCATGGCTTTC -3'
(R):5'- ACAGGCTTCTCTGGACATTTTGGTG -3'

Sequencing Primer
(F):5'- CTTTCCTAGAGGATGGGAACCATAC -3'
(R):5'- GGTTGCAGATTGCTACAAAGC -3'
Posted On2014-01-15