Incidental Mutation 'R1220:Acsm1'
ID100004
Institutional Source Beutler Lab
Gene Symbol Acsm1
Ensembl Gene ENSMUSG00000033533
Gene Nameacyl-CoA synthetase medium-chain family member 1
SynonymsBucs1, Macs
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119607026-119662515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119658314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 407 (S407R)
Ref Sequence ENSEMBL: ENSMUSP00000120146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047929] [ENSMUST00000135683]
Predicted Effect probably benign
Transcript: ENSMUST00000047929
AA Change: S434R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036140
Gene: ENSMUSG00000033533
AA Change: S434R

DomainStartEndE-ValueType
Pfam:AMP-binding 58 471 8.1e-70 PFAM
Pfam:AMP-binding_C 479 559 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135683
AA Change: S407R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120146
Gene: ENSMUSG00000033533
AA Change: S407R

DomainStartEndE-ValueType
Pfam:AMP-binding 58 371 6.8e-51 PFAM
Pfam:AMP-binding 368 444 9e-15 PFAM
Pfam:AMP-binding_C 452 531 5.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Acsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Acsm1 APN 7 119658301 missense possibly damaging 0.46
IGL02121:Acsm1 APN 7 119658412 missense possibly damaging 0.76
IGL02480:Acsm1 APN 7 119656042 missense possibly damaging 0.94
IGL02806:Acsm1 APN 7 119636638 missense probably benign 0.02
IGL03126:Acsm1 APN 7 119633180 missense possibly damaging 0.74
wallball UTSW 7 119640694 missense possibly damaging 0.83
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0090:Acsm1 UTSW 7 119662189 splice site probably benign
R0396:Acsm1 UTSW 7 119636455 missense probably damaging 1.00
R0491:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R0575:Acsm1 UTSW 7 119659201 critical splice donor site probably null
R1366:Acsm1 UTSW 7 119658288 splice site probably benign
R1624:Acsm1 UTSW 7 119652573 missense probably damaging 1.00
R2049:Acsm1 UTSW 7 119656039 missense probably damaging 1.00
R2937:Acsm1 UTSW 7 119659127 missense probably damaging 1.00
R4657:Acsm1 UTSW 7 119640694 missense possibly damaging 0.83
R4814:Acsm1 UTSW 7 119655464 missense probably benign
R5153:Acsm1 UTSW 7 119640727 missense possibly damaging 0.72
R5329:Acsm1 UTSW 7 119656051 missense probably benign 0.03
R5471:Acsm1 UTSW 7 119660606 missense probably damaging 1.00
R5645:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R6153:Acsm1 UTSW 7 119633066 missense probably damaging 1.00
R6406:Acsm1 UTSW 7 119662261 missense probably benign 0.01
R7068:Acsm1 UTSW 7 119622580 missense probably benign
R7311:Acsm1 UTSW 7 119638082 missense probably damaging 1.00
R8293:Acsm1 UTSW 7 119638096 missense possibly damaging 0.83
R8486:Acsm1 UTSW 7 119660657 missense probably damaging 0.98
R8785:Acsm1 UTSW 7 119662230 missense probably benign 0.00
Z1177:Acsm1 UTSW 7 119662278 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGAATGGTGCTCACAGATGG -3'
(R):5'- ATTTAGGCTCTCACACATGGATGGC -3'

Sequencing Primer
(F):5'- TGCTCACAGATGGAGCTGC -3'
(R):5'- ccttgaaatcactctgttgcc -3'
Posted On2014-01-15