Incidental Mutation 'R1220:Cttn'
ID100006
Institutional Source Beutler Lab
Gene Symbol Cttn
Ensembl Gene ENSMUSG00000031078
Gene Namecortactin
SynonymsEms1, 1110020L01Rik
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R1220 (G1)
Quality Score127
Status Validated
Chromosome7
Chromosomal Location144435733-144471009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144463962 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 13 (T13A)
Ref Sequence ENSEMBL: ENSMUSP00000099368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033407] [ENSMUST00000103079]
PDB Structure []
Lysozyme contamination facilitates crystallization of a hetero-trimericCortactin:Arg:Lysozyme complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033407
AA Change: T13A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033407
Gene: ENSMUSG00000031078
AA Change: T13A

DomainStartEndE-ValueType
Pfam:HS1_rep 83 119 1.3e-22 PFAM
Pfam:HS1_rep 120 156 8.6e-25 PFAM
Pfam:HS1_rep 157 193 3.4e-25 PFAM
Pfam:HS1_rep 194 230 1.9e-23 PFAM
Pfam:HS1_rep 231 267 1.2e-24 PFAM
Pfam:HS1_rep 268 293 2.4e-10 PFAM
coiled coil region 311 364 N/A INTRINSIC
SH3 454 509 6.84e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103079
AA Change: T13A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099368
Gene: ENSMUSG00000031078
AA Change: T13A

DomainStartEndE-ValueType
Pfam:HS1_rep 83 118 2.7e-22 PFAM
Pfam:HS1_rep 120 155 2.9e-23 PFAM
Pfam:HS1_rep 157 192 8.2e-24 PFAM
Pfam:HS1_rep 194 229 7.5e-22 PFAM
Pfam:HS1_rep 231 266 6.6e-25 PFAM
Pfam:HS1_rep 268 303 2.3e-22 PFAM
Pfam:HS1_rep 305 332 4.3e-13 PFAM
coiled coil region 348 401 N/A INTRINSIC
SH3 491 546 6.84e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148778
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in breast cancer and squamous cell carcinomas of the head and neck. The encoded protein is localized in the cytoplasm and in areas of the cell-substratum contacts. This gene has two roles: (1) regulating the interactions between components of adherens-type junctions and (2) organizing the cytoskeleton and cell adhesion structures of epithelia and carcinoma cells. During apoptosis, the encoded protein is degraded in a caspase-dependent manner. The aberrant regulation of this gene contributes to tumor cell invasion and metastasis. Three splice variants that encode different isoforms have been identified for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit abnormal early zygote development and die prior to the 2-cell stage. Mice homozygous for a different knock-out allele exhibit increased permeability in vascular and lung endothelial cells and impaired neutrophil extravasation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Cttn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Cttn APN 7 144457727 missense probably damaging 0.99
IGL01432:Cttn APN 7 144461306 missense probably damaging 0.98
IGL02652:Cttn APN 7 144441731 missense probably benign 0.00
PIT4377001:Cttn UTSW 7 144440096 missense possibly damaging 0.71
R0226:Cttn UTSW 7 144441852 splice site probably benign
R0346:Cttn UTSW 7 144452539 splice site probably benign
R3807:Cttn UTSW 7 144445851 missense probably damaging 1.00
R4080:Cttn UTSW 7 144457724 missense probably damaging 1.00
R4578:Cttn UTSW 7 144454716 missense probably damaging 1.00
R5806:Cttn UTSW 7 144461268 missense probably damaging 0.99
R6835:Cttn UTSW 7 144456497 critical splice acceptor site probably null
R6985:Cttn UTSW 7 144452587 nonsense probably null
R7883:Cttn UTSW 7 144445818 missense probably benign 0.00
R8143:Cttn UTSW 7 144461262 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTAACTTGTATGCCCTGAGACC -3'
(R):5'- TGGAGTTCAGTGACTGTCCTCTGC -3'

Sequencing Primer
(F):5'- TTGTATGCCCTGAGACCTAAACAG -3'
(R):5'- TCTTGCAGATGTGGAAAGCC -3'
Posted On2014-01-15