Incidental Mutation 'R1220:Fam118b'
ID100008
Institutional Source Beutler Lab
Gene Symbol Fam118b
Ensembl Gene ENSMUSG00000050471
Gene Namefamily with sequence similarity 118, member B
Synonyms
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35216965-35267805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35223673 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 213 (S213G)
Ref Sequence ENSEMBL: ENSMUSP00000113537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000132799] [ENSMUST00000214230] [ENSMUST00000217306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059057
AA Change: S213G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471
AA Change: S213G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
AA Change: S137G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471
AA Change: S137G

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121564
AA Change: S213G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471
AA Change: S213G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125087
AA Change: S213G

PolyPhen 2 Score 0.706 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471
AA Change: S213G

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132799
SMART Domains Protein: ENSMUSP00000115104
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP54 3 132 8.6e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000133739
AA Change: S95G
SMART Domains Protein: ENSMUSP00000121690
Gene: ENSMUSG00000050471
AA Change: S95G

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214230
Predicted Effect probably benign
Transcript: ENSMUST00000217306
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Fam118b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1293:Fam118b UTSW 9 35221425 missense probably damaging 1.00
R2079:Fam118b UTSW 9 35223664 missense possibly damaging 0.91
R4660:Fam118b UTSW 9 35235255 missense possibly damaging 0.86
R6418:Fam118b UTSW 9 35235337 missense probably damaging 1.00
R7000:Fam118b UTSW 9 35235264 missense probably damaging 1.00
R7016:Fam118b UTSW 9 35223718 missense probably damaging 1.00
R7095:Fam118b UTSW 9 35221490 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTCCTGAAAACCTCTAGCACCG -3'
(R):5'- TAGTCCTCAGGCAGCCTCTTACAC -3'

Sequencing Primer
(F):5'- ATTCCCCAGGATGGTATGCAC -3'
(R):5'- AGCCTCTTACACACTGTGAC -3'
Posted On2014-01-15