Incidental Mutation 'R1220:Pmel'
ID100018
Institutional Source Beutler Lab
Gene Symbol Pmel
Ensembl Gene ENSMUSG00000025359
Gene Namepremelanosome protein
SynonymsPmel17, gp100, D10H12S53E, Si, D12S53Eh, gp87
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128704195-128720238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128714060 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 30 (D30G)
Ref Sequence ENSEMBL: ENSMUSP00000151602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054125] [ENSMUST00000217836] [ENSMUST00000219157]
Predicted Effect probably benign
Transcript: ENSMUST00000054125
AA Change: D30G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000051869
Gene: ENSMUSG00000025359
AA Change: D30G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
PKD 228 310 3.17e-7 SMART
low complexity region 326 348 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217836
AA Change: D30G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000219157
AA Change: D30G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0714 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: This mutation affects the viability of melanoblasts, resulting in random occurrence of white, partially white or gray hairs, and fully pigmented hairs that together display as varying intensities of silvering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Pmel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Pmel APN 10 128716089 missense possibly damaging 0.83
IGL01788:Pmel APN 10 128717832 missense probably damaging 1.00
IGL03205:Pmel APN 10 128716448 missense probably benign 0.05
R0288:Pmel UTSW 10 128714306 missense probably benign
R0944:Pmel UTSW 10 128715257 missense possibly damaging 0.82
R1429:Pmel UTSW 10 128718992 splice site probably null
R5222:Pmel UTSW 10 128718984 unclassified probably null
R5689:Pmel UTSW 10 128716301 missense probably damaging 1.00
R5767:Pmel UTSW 10 128714381 missense probably damaging 0.99
R6145:Pmel UTSW 10 128715935 missense probably damaging 1.00
R7287:Pmel UTSW 10 128715226 nonsense probably null
R7410:Pmel UTSW 10 128716484 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CAGGTGTTGGGTCCTCAATTCAGTC -3'
(R):5'- GCATTTGCACCAACCAGTGTAGGC -3'

Sequencing Primer
(F):5'- GGGTCCTCAATTCAGTCTCAGTG -3'
(R):5'- TGACCCTCAGAGATACCTGGC -3'
Posted On2014-01-15