Mutagenetix > Incidental Mutations

Incidental Mutation 'R1220:Eif4enif1'

100019

Institutional Source

Beutler Lab

Gene Symbol

Eif4enif1

Ensembl Gene

ENSMUSG00000020454

Gene Name

eukaryotic translation initiation factor 4E nuclear import factor 1

Synonyms

D11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik

MMRRC Submission

039289-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.554) question?

Stock #

R1220 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

3202392-3244588 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 3239493 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]

Predicted Effect

probably benign
Transcript: ENSMUST00000020734

SMART Domains

Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110048

SMART Domains

Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110049

SMART Domains

Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	712	2.7e-184	PFAM
low complexity region	859	875	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120721

SMART Domains

Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	99	3.6e-29	PFAM
Pfam:EIF4E-T	98	327	5.1e-41	PFAM
Pfam:EIF4E-T	282	537	7.7e-30	PFAM
low complexity region	684	700	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127950

Predicted Effect

probably benign
Transcript: ENSMUST00000135223

SMART Domains

Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	1	239	1.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147534

Predicted Effect

probably benign
Transcript: ENSMUST00000159304

SMART Domains

Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

Domain	Start	End	E-Value	Type
Pfam:TGS	13	58	5.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179770

SMART Domains

Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	710	4.3e-160	PFAM
low complexity region	859	875	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm1	C	A	7: 119,658,314	S407R	probably benign	Het
Add2	A	T	6: 86,087,000	M94L	possibly damaging	Het
Anks6	A	T	4: 47,025,767		probably benign	Het
Atxn1	A	G	13: 45,557,423	S678P	probably benign	Het
Ccnc	A	G	4: 21,732,491	Y76C	probably damaging	Het
Col1a1	G	T	11: 94,951,131	A1335S	unknown	Het
Col25a1	G	T	3: 130,388,925		probably benign	Het
Commd10	C	A	18: 47,087,040	Q195K	probably damaging	Het
Cps1	G	A	1: 67,204,703		probably null	Het
Cramp1l	A	T	17: 24,982,237	V757D	probably damaging	Het
Cttn	T	C	7: 144,463,962	T13A	probably benign	Het
Eftud2	A	G	11: 102,851,747		probably benign	Het
Exoc3l2	T	A	7: 19,491,784		probably benign	Het
Fam118b	T	C	9: 35,223,673	S213G	possibly damaging	Het
Katnal1	G	A	5: 148,894,251	A171V	probably benign	Het
Lrig3	A	G	10: 125,997,076	N273S	probably damaging	Het
Lrriq1	G	A	10: 103,071,129	R1577W	probably benign	Het
Olfr385	A	C	11: 73,589,377	Y120*	probably null	Het
Olfr495	T	A	7: 108,395,332	S71T	probably benign	Het
Pmel	A	G	10: 128,714,060	D30G	probably benign	Het
Ppp1r15a	T	C	7: 45,523,869	Y505C	probably damaging	Het
Prpf40b	C	T	15: 99,316,348	R830C	probably benign	Het
Rabgap1l	A	T	1: 160,738,909	D106E	probably damaging	Het
Rad18	C	A	6: 112,649,664	E141*	probably null	Het
Ros1	C	T	10: 52,098,870	V1540M	probably damaging	Het
Secisbp2	G	A	13: 51,656,905	R201H	probably damaging	Het
Shisa6	A	G	11: 66,220,010	S302P	probably damaging	Het
Slamf9	C	A	1: 172,477,331	Q171K	probably benign	Het
Sox6	T	A	7: 115,662,442	T180S	probably damaging	Het
Ttn	T	C	2: 76,723,654	S30902G	possibly damaging	Het
Xirp1	A	G	9: 120,017,916	F634L	possibly damaging	Het
Yrdc	T	A	4: 124,854,536	S278T	possibly damaging	Het

Other mutations in Eif4enif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Eif4enif1	APN	11	3221143	missense	probably damaging	0.96
IGL02237:Eif4enif1	APN	11	3227876	nonsense	probably null
IGL02372:Eif4enif1	APN	11	3229986	missense	probably benign	0.09
PIT4283001:Eif4enif1	UTSW	11	3234464	missense	probably damaging	1.00
R0079:Eif4enif1	UTSW	11	3242676	nonsense	probably null
R1177:Eif4enif1	UTSW	11	3229902	missense	probably damaging	1.00
R1511:Eif4enif1	UTSW	11	3236278	missense	probably benign	0.00
R1675:Eif4enif1	UTSW	11	3215686	missense	probably benign	0.02
R1908:Eif4enif1	UTSW	11	3227455	missense	probably damaging	1.00
R1940:Eif4enif1	UTSW	11	3243279	missense	probably damaging	1.00
R2173:Eif4enif1	UTSW	11	3242367	splice site	probably null
R2215:Eif4enif1	UTSW	11	3227476	missense	probably damaging	1.00
R2517:Eif4enif1	UTSW	11	3221168	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2873:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R3147:Eif4enif1	UTSW	11	3244003	unclassified	probably null
R4195:Eif4enif1	UTSW	11	3243186	missense	possibly damaging	0.89
R4196:Eif4enif1	UTSW	11	3243186	missense	possibly damaging	0.89
R4708:Eif4enif1	UTSW	11	3220323	missense	probably damaging	1.00
R4755:Eif4enif1	UTSW	11	3244016	missense	probably damaging	1.00
R5310:Eif4enif1	UTSW	11	3242687	missense	probably damaging	1.00
R5546:Eif4enif1	UTSW	11	3243989	missense	probably damaging	0.99
R5816:Eif4enif1	UTSW	11	3242401	missense	probably benign	0.13
R6018:Eif4enif1	UTSW	11	3242481	missense	probably damaging	0.97
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6267:Eif4enif1	UTSW	11	3227793	missense	probably damaging	1.00
R6514:Eif4enif1	UTSW	11	3240996	missense	probably null	0.01
R6638:Eif4enif1	UTSW	11	3242463	missense	probably damaging	0.96
R7040:Eif4enif1	UTSW	11	3234040	missense	probably benign	0.33
R7232:Eif4enif1	UTSW	11	3215678	missense	possibly damaging	0.75
R7385:Eif4enif1	UTSW	11	3220269	missense	probably damaging	1.00
R7478:Eif4enif1	UTSW	11	3227709	nonsense	probably null
R7749:Eif4enif1	UTSW	11	3242608	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCTCAGGTATTGACTGTTCCCAC -3'
(R):5'- TACATGTCATGAGGTGCTAGGCCC -3'

Sequencing Primer
(F):5'- GGTATTGACTGTTCCCACTACAGAG -3'
(R):5'- AGGCCCAGCTATTTTTTAAGCAC -3'

Posted On

2014-01-15