Incidental Mutation 'R1177:Bivm'
ID100020
Institutional Source Beutler Lab
Gene Symbol Bivm
Ensembl Gene ENSMUSG00000041684
Gene Namebasic, immunoglobulin-like variable motif containing
Synonyms
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44118957-44144770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44142963 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 444 (V444I)
Ref Sequence ENSEMBL: ENSMUSP00000110357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214] [ENSMUST00000035991] [ENSMUST00000114709]
Predicted Effect probably benign
Transcript: ENSMUST00000027214
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035991
AA Change: V444I

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684
AA Change: V444I

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114709
AA Change: V444I

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684
AA Change: V444I

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188376
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Bivm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Bivm APN 1 44129291 missense probably damaging 1.00
IGL01384:Bivm APN 1 44126747 missense possibly damaging 0.86
IGL01552:Bivm APN 1 44126773 missense probably benign 0.40
IGL01736:Bivm APN 1 44141813 missense probably damaging 1.00
IGL02332:Bivm APN 1 44128720 unclassified probably benign
IGL02704:Bivm APN 1 44126446 missense probably benign
IGL02859:Bivm APN 1 44136999 nonsense probably null
IGL02939:Bivm APN 1 44142960 missense probably benign 0.03
IGL03265:Bivm APN 1 44141845 missense probably damaging 1.00
R0456:Bivm UTSW 1 44126809 missense probably damaging 1.00
R1172:Bivm UTSW 1 44126782 missense probably benign 0.04
R1173:Bivm UTSW 1 44126782 missense probably benign 0.04
R1174:Bivm UTSW 1 44126782 missense probably benign 0.04
R1350:Bivm UTSW 1 44126703 missense possibly damaging 0.88
R1611:Bivm UTSW 1 44126747 missense possibly damaging 0.92
R2518:Bivm UTSW 1 44129615 missense probably damaging 0.96
R3735:Bivm UTSW 1 44126434 missense probably benign 0.07
R4290:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4292:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4293:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4294:Bivm UTSW 1 44138633 missense probably damaging 1.00
R4849:Bivm UTSW 1 44142873 missense possibly damaging 0.70
R5204:Bivm UTSW 1 44138578 missense probably damaging 0.96
R5912:Bivm UTSW 1 44126413 nonsense probably null
R6045:Bivm UTSW 1 44119073 start gained probably benign
R6216:Bivm UTSW 1 44126868 critical splice donor site probably null
R6836:Bivm UTSW 1 44143136 missense possibly damaging 0.88
R7120:Bivm UTSW 1 44126446 missense probably benign
R7817:Bivm UTSW 1 44126401 missense probably benign 0.01
Predicted Primers
Posted On2014-01-15