Incidental Mutation 'R1220:Shisa6'
ID100021
Institutional Source Beutler Lab
Gene Symbol Shisa6
Ensembl Gene ENSMUSG00000053930
Gene Nameshisa family member 6
SynonymsGm879, LOC380702
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location66211725-66525964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66220010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 302 (S302P)
Ref Sequence ENSEMBL: ENSMUSP00000071025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066679]
Predicted Effect probably damaging
Transcript: ENSMUST00000066679
AA Change: S302P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071025
Gene: ENSMUSG00000053930
AA Change: S302P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 42 59 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Pfam:Shisa 97 294 6.3e-43 PFAM
low complexity region 378 389 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123454
AA Change: S277P
SMART Domains Protein: ENSMUSP00000120862
Gene: ENSMUSG00000053930
AA Change: S277P

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
Pfam:Shisa 41 227 2.4e-43 PFAM
low complexity region 354 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144922
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Shisa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Shisa6 APN 11 66217828 missense possibly damaging 0.94
IGL01620:Shisa6 APN 11 66217879 missense probably benign 0.03
IGL02702:Shisa6 APN 11 66219962 missense probably damaging 1.00
IGL02810:Shisa6 APN 11 66224948 missense possibly damaging 0.64
IGL03029:Shisa6 APN 11 66218013 missense probably damaging 1.00
R0363:Shisa6 UTSW 11 66525327 missense probably benign 0.17
R1264:Shisa6 UTSW 11 66375149 splice site probably benign
R2495:Shisa6 UTSW 11 66217633 missense probably damaging 1.00
R3962:Shisa6 UTSW 11 66217476 missense probably damaging 1.00
R4449:Shisa6 UTSW 11 66525418 missense probably benign 0.18
R5872:Shisa6 UTSW 11 66217974 missense probably damaging 1.00
R6059:Shisa6 UTSW 11 66224974 missense probably damaging 0.98
R6172:Shisa6 UTSW 11 66218006 missense probably benign 0.28
R6849:Shisa6 UTSW 11 66525501 missense probably benign 0.01
R6903:Shisa6 UTSW 11 66375156 splice site probably null
R7282:Shisa6 UTSW 11 66502654 missense possibly damaging 0.94
R7450:Shisa6 UTSW 11 66218006 missense probably benign 0.28
RF008:Shisa6 UTSW 11 66525923 unclassified probably benign
Z1176:Shisa6 UTSW 11 66375227 missense
Predicted Primers PCR Primer
(F):5'- CCCCTGGTGAGCTGATACATGAATG -3'
(R):5'- GTCCCAACTGAGTCTTCAAGGACTG -3'

Sequencing Primer
(F):5'- TGAAAGAAAGGCTATCCTCTTCATCC -3'
(R):5'- TTCTCCCAGGGATCTAAGCAG -3'
Posted On2014-01-15