Mutagenetix > Incidental Mutation

Incidental Mutation 'R1220:Eftud2'

100027

Institutional Source

Beutler Lab

Gene Symbol

Eftud2

Ensembl Gene

ENSMUSG00000020929

Gene Name

elongation factor Tu GTP binding domain containing 2

Synonyms

116kDa, Snrp116, U5-116kD

MMRRC Submission

039289-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1220 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102838473-102880985 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 102851747 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000107060] [ENSMUST00000173679]

AlphaFold

O08810

Predicted Effect

probably benign
Transcript: ENSMUST00000021306

SMART Domains

Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

Domain	Start	End	E-Value	Type
Pfam:EFTUD2	3	110	1.1e-42	PFAM
Pfam:GTP_EFTU	127	440	9.6e-47	PFAM
Pfam:GTP_EFTU_D2	489	566	3.8e-15	PFAM
Pfam:EFG_II	584	656	9.9e-11	PFAM
EFG_IV	703	824	1.1e-16	SMART
EFG_C	826	915	1.14e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107060

SMART Domains

Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
low complexity region	32	50	N/A	INTRINSIC
Pfam:GTP_EFTU	126	439	9.6e-44	PFAM
Pfam:Miro	130	260	2.5e-6	PFAM
Pfam:GTP_EFTU_D2	488	565	7.9e-13	PFAM
Pfam:EFG_II	583	655	8.2e-10	PFAM
EFG_IV	702	823	1.1e-16	SMART
EFG_C	825	914	1.14e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141273

Predicted Effect

probably benign
Transcript: ENSMUST00000173679

SMART Domains

Protein: ENSMUSP00000134327
Gene: ENSMUSG00000020929

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
low complexity region	29	51	N/A	INTRINSIC
Pfam:GTP_EFTU	127	430	2.2e-36	PFAM
Pfam:GTP_EFTU_D2	479	556	7.8e-13	PFAM
Pfam:EFG_II	574	646	8.1e-10	PFAM
EFG_IV	693	814	1.1e-16	SMART
EFG_C	816	905	1.14e-14	SMART

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.2%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase which is a component of the spliceosome complex which processes precursor mRNAs to produce mature mRNAs. Mutations in this gene are associated with mandibulofacial dysostosis with microcephaly. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm1	C	A	7: 119,658,314	S407R	probably benign	Het
Add2	A	T	6: 86,087,000	M94L	possibly damaging	Het
Anks6	A	T	4: 47,025,767		probably benign	Het
Atxn1	A	G	13: 45,557,423	S678P	probably benign	Het
Ccnc	A	G	4: 21,732,491	Y76C	probably damaging	Het
Col1a1	G	T	11: 94,951,131	A1335S	unknown	Het
Col25a1	G	T	3: 130,388,925		probably benign	Het
Commd10	C	A	18: 47,087,040	Q195K	probably damaging	Het
Cps1	G	A	1: 67,204,703		probably null	Het
Cramp1l	A	T	17: 24,982,237	V757D	probably damaging	Het
Cttn	T	C	7: 144,463,962	T13A	probably benign	Het
Eif4enif1	A	G	11: 3,239,493		probably benign	Het
Exoc3l2	T	A	7: 19,491,784		probably benign	Het
Fam118b	T	C	9: 35,223,673	S213G	possibly damaging	Het
Katnal1	G	A	5: 148,894,251	A171V	probably benign	Het
Lrig3	A	G	10: 125,997,076	N273S	probably damaging	Het
Lrriq1	G	A	10: 103,071,129	R1577W	probably benign	Het
Olfr385	A	C	11: 73,589,377	Y120*	probably null	Het
Olfr495	T	A	7: 108,395,332	S71T	probably benign	Het
Pmel	A	G	10: 128,714,060	D30G	probably benign	Het
Ppp1r15a	T	C	7: 45,523,869	Y505C	probably damaging	Het
Prpf40b	C	T	15: 99,316,348	R830C	probably benign	Het
Rabgap1l	A	T	1: 160,738,909	D106E	probably damaging	Het
Rad18	C	A	6: 112,649,664	E141*	probably null	Het
Ros1	C	T	10: 52,098,870	V1540M	probably damaging	Het
Secisbp2	G	A	13: 51,656,905	R201H	probably damaging	Het
Shisa6	A	G	11: 66,220,010	S302P	probably damaging	Het
Slamf9	C	A	1: 172,477,331	Q171K	probably benign	Het
Sox6	T	A	7: 115,662,442	T180S	probably damaging	Het
Ttn	T	C	2: 76,723,654	S30902G	possibly damaging	Het
Xirp1	A	G	9: 120,017,916	F634L	possibly damaging	Het
Yrdc	T	A	4: 124,854,536	S278T	possibly damaging	Het

Other mutations in Eftud2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Eftud2	APN	11	102865563	splice site	probably benign
IGL01765:Eftud2	APN	11	102839256	missense	probably damaging	0.99
IGL01868:Eftud2	APN	11	102869127	missense	probably benign	0.08
IGL02161:Eftud2	APN	11	102854876	splice site	probably benign
IGL02165:Eftud2	APN	11	102851747	splice site	probably benign
IGL02218:Eftud2	APN	11	102870213	missense	possibly damaging	0.46
IGL02386:Eftud2	APN	11	102851754	splice site	probably null
IGL02664:Eftud2	APN	11	102841712	missense	probably damaging	1.00
IGL02677:Eftud2	APN	11	102846614	missense	probably damaging	1.00
IGL02792:Eftud2	APN	11	102870256	splice site	probably benign
IGL02870:Eftud2	APN	11	102862626	missense	probably damaging	0.97
IGL03131:Eftud2	APN	11	102870183	missense	probably damaging	1.00
R0137:Eftud2	UTSW	11	102868617	missense	possibly damaging	0.94
R0244:Eftud2	UTSW	11	102864725	missense	probably damaging	0.97
R0358:Eftud2	UTSW	11	102864801	splice site	probably benign
R0463:Eftud2	UTSW	11	102864771	missense	probably damaging	1.00
R0511:Eftud2	UTSW	11	102844222	missense	probably damaging	1.00
R0525:Eftud2	UTSW	11	102839253	missense	probably damaging	1.00
R0586:Eftud2	UTSW	11	102846620	missense	probably damaging	1.00
R0751:Eftud2	UTSW	11	102839253	missense	probably damaging	1.00
R1034:Eftud2	UTSW	11	102849184	missense	probably benign
R1079:Eftud2	UTSW	11	102840044	nonsense	probably null
R1208:Eftud2	UTSW	11	102864766	missense	probably benign	0.22
R1208:Eftud2	UTSW	11	102864766	missense	probably benign	0.22
R1438:Eftud2	UTSW	11	102860042	missense	probably damaging	1.00
R1520:Eftud2	UTSW	11	102839440	missense	probably damaging	1.00
R1569:Eftud2	UTSW	11	102854771	splice site	probably benign
R2270:Eftud2	UTSW	11	102864781	missense	probably damaging	1.00
R3500:Eftud2	UTSW	11	102844180	missense	probably damaging	1.00
R3686:Eftud2	UTSW	11	102844201	missense	probably damaging	1.00
R3687:Eftud2	UTSW	11	102844201	missense	probably damaging	1.00
R3688:Eftud2	UTSW	11	102844201	missense	probably damaging	1.00
R3808:Eftud2	UTSW	11	102841463	splice site	probably null
R3892:Eftud2	UTSW	11	102846187	missense	probably damaging	0.99
R4003:Eftud2	UTSW	11	102860110	missense	possibly damaging	0.51
R4091:Eftud2	UTSW	11	102839416	splice site	probably null
R4794:Eftud2	UTSW	11	102870177	missense	probably benign	0.14
R4841:Eftud2	UTSW	11	102854814	missense	probably damaging	1.00
R4842:Eftud2	UTSW	11	102854814	missense	probably damaging	1.00
R5151:Eftud2	UTSW	11	102867844	critical splice donor site	probably null
R5208:Eftud2	UTSW	11	102841185	missense	probably damaging	1.00
R6199:Eftud2	UTSW	11	102840057	missense	probably damaging	1.00
R6357:Eftud2	UTSW	11	102864780	missense	probably damaging	1.00
R6720:Eftud2	UTSW	11	102838623	nonsense	probably null
R7604:Eftud2	UTSW	11	102848012	missense	possibly damaging	0.87
R7886:Eftud2	UTSW	11	102840108	missense	probably damaging	1.00
R8017:Eftud2	UTSW	11	102843348	critical splice donor site	probably null
R8019:Eftud2	UTSW	11	102843348	critical splice donor site	probably null
R8139:Eftud2	UTSW	11	102867859	missense	probably benign	0.04
R8431:Eftud2	UTSW	11	102846236	missense	probably benign	0.08
R8545:Eftud2	UTSW	11	102840271	missense	probably damaging	1.00
R8676:Eftud2	UTSW	11	102868621	missense	probably damaging	1.00
R9089:Eftud2	UTSW	11	102869145	missense	probably benign
R9173:Eftud2	UTSW	11	102843416	missense	probably damaging	1.00
R9277:Eftud2	UTSW	11	102860029	missense	probably damaging	1.00
R9313:Eftud2	UTSW	11	102839436	missense	probably benign	0.03
R9604:Eftud2	UTSW	11	102846230	missense	probably benign	0.11
R9664:Eftud2	UTSW	11	102868596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCTGACCCCAGTAAATGGACCAAG -3'
(R):5'- ATCAGACTGTTGTTGCCCAGAGCC -3'

Sequencing Primer
(F):5'- CTTCACCTGCATGGGAAATTG -3'
(R):5'- GGTTGTCACTACATAGTTGACCTTC -3'

Posted On

2014-01-15