Incidental Mutation 'R1177:Or4c105'
ID 100028
Institutional Source Beutler Lab
Gene Symbol Or4c105
Ensembl Gene ENSMUSG00000064084
Gene Name olfactory receptor family 4 subfamily C member 105
Synonyms Olfr1202, GA_x6K02T2Q125-50290367-50291296, MOR232-7
MMRRC Submission 039249-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R1177 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 88643145-88648446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88647704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
AlphaFold Q8VF98
Predicted Effect probably benign
Transcript: ENSMUST00000072057
AA Change: Y63C

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214703
AA Change: Y63C

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000217059
AA Change: Y63C

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,664,329 (GRCm39) probably null Het
Bivm G A 1: 44,182,123 (GRCm39) V444I probably benign Het
Cers4 A G 8: 4,566,931 (GRCm39) I78V probably null Het
Chgb A G 2: 132,635,390 (GRCm39) Y444C possibly damaging Het
Col7a1 T C 9: 108,791,509 (GRCm39) V1161A unknown Het
Dpp6 A G 5: 27,868,471 (GRCm39) D478G possibly damaging Het
Eif4enif1 T C 11: 3,179,902 (GRCm39) V274A probably damaging Het
Fkrp T C 7: 16,544,452 (GRCm39) E470G probably damaging Het
Lrrc8c T C 5: 105,754,702 (GRCm39) I159T probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Map3k21 A T 8: 126,671,577 (GRCm39) Q955L probably benign Het
Mast3 A G 8: 71,232,968 (GRCm39) S1115P probably damaging Het
Mga T C 2: 119,756,927 (GRCm39) F1048S probably damaging Het
Mthfd1l A C 10: 3,935,661 (GRCm39) K212T possibly damaging Het
Myo5b G A 18: 74,777,143 (GRCm39) R401H probably damaging Het
Naip1 C T 13: 100,563,572 (GRCm39) S531N possibly damaging Het
Nlrp1a A G 11: 70,998,547 (GRCm39) V884A probably damaging Het
Nop58 T A 1: 59,740,091 (GRCm39) M161K probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nup210l A G 3: 90,109,310 (GRCm39) T1618A probably benign Het
Or10d4 A G 9: 39,580,937 (GRCm39) R195G probably benign Het
Or2b4 A T 17: 38,116,843 (GRCm39) E269V probably benign Het
Ppp4r4 G A 12: 103,542,582 (GRCm39) A115T possibly damaging Het
Rag1 T C 2: 101,472,623 (GRCm39) R840G probably benign Het
Slc44a2 A T 9: 21,259,879 (GRCm39) Q629L probably benign Het
Slc5a6 A G 5: 31,196,646 (GRCm39) probably null Het
Spag1 A T 15: 36,234,913 (GRCm39) T859S probably benign Het
Sv2c G T 13: 96,126,271 (GRCm39) A327E possibly damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tlr2 A G 3: 83,746,041 (GRCm39) I14T probably benign Het
Trpc6 G A 9: 8,658,305 (GRCm39) R725K probably benign Het
Wdr90 A G 17: 26,065,028 (GRCm39) V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,465,891 (GRCm39) probably benign Het
Zfp94 T C 7: 24,002,953 (GRCm39) Y163C probably damaging Het
Other mutations in Or4c105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Or4c105 APN 2 88,647,781 (GRCm39) missense possibly damaging 0.54
R0105:Or4c105 UTSW 2 88,648,253 (GRCm39) missense probably damaging 1.00
R0699:Or4c105 UTSW 2 88,647,568 (GRCm39) missense probably damaging 1.00
R0709:Or4c105 UTSW 2 88,648,226 (GRCm39) missense probably benign 0.42
R1436:Or4c105 UTSW 2 88,648,336 (GRCm39) missense possibly damaging 0.48
R1827:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1828:Or4c105 UTSW 2 88,648,402 (GRCm39) missense probably benign 0.04
R1872:Or4c105 UTSW 2 88,648,280 (GRCm39) missense probably benign 0.02
R1878:Or4c105 UTSW 2 88,647,805 (GRCm39) missense probably benign 0.00
R4903:Or4c105 UTSW 2 88,648,342 (GRCm39) missense probably benign 0.14
R5035:Or4c105 UTSW 2 88,648,443 (GRCm39) missense probably benign 0.01
R6279:Or4c105 UTSW 2 88,647,719 (GRCm39) missense probably damaging 1.00
R7402:Or4c105 UTSW 2 88,647,687 (GRCm39) missense probably damaging 1.00
R7809:Or4c105 UTSW 2 88,647,902 (GRCm39) missense probably damaging 0.96
R8172:Or4c105 UTSW 2 88,647,986 (GRCm39) missense probably damaging 1.00
R8193:Or4c105 UTSW 2 88,647,803 (GRCm39) missense probably damaging 1.00
R8673:Or4c105 UTSW 2 88,647,590 (GRCm39) missense probably benign
R8730:Or4c105 UTSW 2 88,648,043 (GRCm39) missense possibly damaging 0.64
R9459:Or4c105 UTSW 2 88,647,967 (GRCm39) missense probably benign 0.12
R9772:Or4c105 UTSW 2 88,647,958 (GRCm39) missense probably benign
Predicted Primers
Posted On 2014-01-15