Incidental Mutation 'R1220:Secisbp2'
ID100030
Institutional Source Beutler Lab
Gene Symbol Secisbp2
Ensembl Gene ENSMUSG00000035139
Gene NameSECIS binding protein 2
SynonymsSBP2, 2210413N07Rik, 2810012K13Rik
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location51651697-51684044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 51656905 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 201 (R201H)
Ref Sequence ENSEMBL: ENSMUSP00000105671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040117] [ENSMUST00000110044]
Predicted Effect probably damaging
Transcript: ENSMUST00000040117
AA Change: R201H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045740
Gene: ENSMUSG00000035139
AA Change: R201H

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 662 764 4.4e-23 PFAM
low complexity region 793 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110044
AA Change: R201H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105671
Gene: ENSMUSG00000035139
AA Change: R201H

DomainStartEndE-ValueType
low complexity region 179 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154202
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: The incorporation of selenocysteine into a protein requires the concerted action of an mRNA element called a sec insertion sequence (SECIS), a selenocysteine-specific translation elongation factor and a SECIS binding protein. With these elements in place, a UGA codon can be decoded as selenocysteine. The gene described in this record encodes a nuclear protein that functions as a SECIS binding protein. Mutations in a similar gene in human have been associated with a reduction in activity of a specific thyroxine deiodinase, a selenocysteine-containing enzyme, and abnormal thyroid hormone metabolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality while heterozygotes exhibit reduced serum selenium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Secisbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Secisbp2 APN 13 51676455 critical splice donor site probably null
IGL01316:Secisbp2 APN 13 51654516 missense probably benign 0.06
IGL02576:Secisbp2 APN 13 51670858 missense possibly damaging 0.80
IGL02630:Secisbp2 APN 13 51678906 missense possibly damaging 0.63
IGL02645:Secisbp2 APN 13 51682460 missense probably damaging 1.00
IGL03107:Secisbp2 APN 13 51652757 critical splice donor site probably null
R0208:Secisbp2 UTSW 13 51679845 missense probably benign 0.26
R0453:Secisbp2 UTSW 13 51683325 missense possibly damaging 0.91
R1278:Secisbp2 UTSW 13 51654510 missense probably damaging 1.00
R1439:Secisbp2 UTSW 13 51679723 splice site probably benign
R1514:Secisbp2 UTSW 13 51682095 missense possibly damaging 0.83
R1568:Secisbp2 UTSW 13 51673107 missense possibly damaging 0.73
R1724:Secisbp2 UTSW 13 51670846 missense probably benign
R2851:Secisbp2 UTSW 13 51654635 splice site probably null
R2967:Secisbp2 UTSW 13 51670879 missense probably benign 0.00
R3156:Secisbp2 UTSW 13 51662675 missense probably benign 0.06
R4393:Secisbp2 UTSW 13 51654466 missense probably damaging 1.00
R4719:Secisbp2 UTSW 13 51652732 missense possibly damaging 0.96
R4953:Secisbp2 UTSW 13 51682027 missense probably damaging 1.00
R5183:Secisbp2 UTSW 13 51665424 missense probably benign 0.14
R5432:Secisbp2 UTSW 13 51673966 small deletion probably benign
R5696:Secisbp2 UTSW 13 51679821 missense probably damaging 1.00
R6007:Secisbp2 UTSW 13 51665359 missense probably damaging 0.99
R6066:Secisbp2 UTSW 13 51677222 missense probably benign 0.00
R6076:Secisbp2 UTSW 13 51679777 missense probably damaging 0.98
R6164:Secisbp2 UTSW 13 51679860 missense probably damaging 1.00
R6346:Secisbp2 UTSW 13 51679887 missense probably damaging 0.99
R6367:Secisbp2 UTSW 13 51682141 missense probably damaging 1.00
R6790:Secisbp2 UTSW 13 51670903 missense probably benign 0.09
R6888:Secisbp2 UTSW 13 51679941 missense probably benign 0.16
R7095:Secisbp2 UTSW 13 51677254 missense probably benign 0.01
R7104:Secisbp2 UTSW 13 51656907 nonsense probably null
R7261:Secisbp2 UTSW 13 51682462 missense probably damaging 1.00
R7717:Secisbp2 UTSW 13 51673098 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAGTTTGCCTAGCTCAGAAG -3'
(R):5'- ACTCACCTCTACCATATCTGCGACG -3'

Sequencing Primer
(F):5'- TTGCCTAGCTCAGAAGTGATTAAGG -3'
(R):5'- CTCCTAGGAGAGGCATGTTACT -3'
Posted On2014-01-15