Incidental Mutation 'R1220:Prpf40b'
ID100032
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Namepre-mRNA processing factor 40B
Synonyms2610317D23Rik
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R1220 (G1)
Quality Score130
Status Validated
Chromosome15
Chromosomal Location99295087-99317018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99316348 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 830 (R830C)
Ref Sequence ENSEMBL: ENSMUSP00000113282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
Predicted Effect unknown
Transcript: ENSMUST00000023745
AA Change: R829C
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007
AA Change: R829C

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118287
AA Change: R830C

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007
AA Change: R830C

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124275
Predicted Effect silent
Transcript: ENSMUST00000126955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130575
Predicted Effect unknown
Transcript: ENSMUST00000134034
AA Change: R216C
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007
AA Change: R216C

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136980
AA Change: R817C
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007
AA Change: R817C

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139330
Predicted Effect unknown
Transcript: ENSMUST00000145482
AA Change: R833C
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007
AA Change: R833C

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153692
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0284:Prpf40b UTSW 15 99316393 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4449:Prpf40b UTSW 15 99314663 missense probably damaging 1.00
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6734:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6776:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGACTTCCTATCTCTGCCCAG -3'
(R):5'- TGAGAACTAGGGGACCCTTGAACAC -3'

Sequencing Primer
(F):5'- TCATGGTCTTCGGAAAACCAAG -3'
(R):5'- GCAACCTTGAGAGGTGCTAAC -3'
Posted On2014-01-15