Incidental Mutation 'R1220:Cramp1l'
ID100034
Institutional Source Beutler Lab
Gene Symbol Cramp1l
Ensembl Gene ENSMUSG00000038002
Gene Namecramped chromatin regulator homolog 1
Synonyms5830477H08Rik, Tce4
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1220 (G1)
Quality Score156
Status Validated
Chromosome17
Chromosomal Location24961228-25015230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24982237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 757 (V757D)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: V757D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: V757D

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.3348 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Commd10 C A 18: 47,087,040 Q195K probably damaging Het
Cps1 G A 1: 67,204,703 probably null Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Cramp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1l APN 17 24983951 missense probably benign 0.11
IGL01360:Cramp1l APN 17 24997573 missense probably damaging 1.00
IGL01966:Cramp1l APN 17 24982943 missense probably benign 0.01
IGL02211:Cramp1l APN 17 24977636 missense possibly damaging 0.94
IGL02474:Cramp1l APN 17 24985050 missense probably damaging 0.98
IGL02798:Cramp1l APN 17 24968920 splice site probably benign
IGL03340:Cramp1l APN 17 24973542 missense probably damaging 1.00
R0106:Cramp1l UTSW 17 24972376 missense probably benign 0.30
R1054:Cramp1l UTSW 17 24983177 missense probably damaging 1.00
R1341:Cramp1l UTSW 17 24977540 missense probably damaging 1.00
R1491:Cramp1l UTSW 17 24972349 missense probably benign 0.17
R1610:Cramp1l UTSW 17 24983951 missense probably benign 0.11
R1649:Cramp1l UTSW 17 24983243 missense probably damaging 1.00
R1795:Cramp1l UTSW 17 24964910 missense probably damaging 1.00
R1856:Cramp1l UTSW 17 24968978 missense probably damaging 1.00
R1881:Cramp1l UTSW 17 24977682 splice site probably benign
R1968:Cramp1l UTSW 17 24964939 missense probably damaging 1.00
R2047:Cramp1l UTSW 17 25003215 nonsense probably null
R2099:Cramp1l UTSW 17 24973085 missense probably benign 0.01
R2298:Cramp1l UTSW 17 24997480 missense probably damaging 0.96
R3752:Cramp1l UTSW 17 24971558 missense probably damaging 1.00
R3821:Cramp1l UTSW 17 24974782 missense probably damaging 1.00
R3861:Cramp1l UTSW 17 24997614 splice site probably benign
R4399:Cramp1l UTSW 17 24979585 missense probably damaging 1.00
R4847:Cramp1l UTSW 17 24985089 missense probably damaging 1.00
R4883:Cramp1l UTSW 17 24982319 missense probably benign
R5579:Cramp1l UTSW 17 24973113 missense possibly damaging 0.89
R5631:Cramp1l UTSW 17 24985603 missense possibly damaging 0.93
R5716:Cramp1l UTSW 17 24974735 missense probably damaging 0.99
R6589:Cramp1l UTSW 17 24977492 splice site probably null
R6631:Cramp1l UTSW 17 24983957 missense probably benign 0.40
R7307:Cramp1l UTSW 17 24974745 missense possibly damaging 0.94
R7323:Cramp1l UTSW 17 24982405 missense possibly damaging 0.90
R7672:Cramp1l UTSW 17 24982466 missense probably damaging 0.96
R7832:Cramp1l UTSW 17 24983222 missense probably damaging 0.96
R8071:Cramp1l UTSW 17 24982700 missense probably damaging 0.99
R8244:Cramp1l UTSW 17 24971410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGGCTAGAACCTCTCACTTC -3'
(R):5'- ATGATGGGCAAGCCGACCAAAC -3'

Sequencing Primer
(F):5'- TTCCATAGTGCTGAGGCCAAG -3'
(R):5'- CCAAACTGCAGCTGGAGTAT -3'
Posted On2014-01-15