Incidental Mutation 'R1220:Commd10'
ID100036
Institutional Source Beutler Lab
Gene Symbol Commd10
Ensembl Gene ENSMUSG00000042705
Gene NameCOMM domain containing 10
Synonyms2310003A05Rik, DRWMS2
MMRRC Submission 039289-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1220 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46958862-47087992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47087040 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 195 (Q195K)
Ref Sequence ENSEMBL: ENSMUSP00000041650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049388]
Predicted Effect probably damaging
Transcript: ENSMUST00000049388
AA Change: Q195K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041650
Gene: ENSMUSG00000042705
AA Change: Q195K

DomainStartEndE-ValueType
Pfam:HCaRG 21 200 6.8e-39 PFAM
Meta Mutation Damage Score 0.1723 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C A 7: 119,658,314 S407R probably benign Het
Add2 A T 6: 86,087,000 M94L possibly damaging Het
Anks6 A T 4: 47,025,767 probably benign Het
Atxn1 A G 13: 45,557,423 S678P probably benign Het
Ccnc A G 4: 21,732,491 Y76C probably damaging Het
Col1a1 G T 11: 94,951,131 A1335S unknown Het
Col25a1 G T 3: 130,388,925 probably benign Het
Cps1 G A 1: 67,204,703 probably null Het
Cramp1l A T 17: 24,982,237 V757D probably damaging Het
Cttn T C 7: 144,463,962 T13A probably benign Het
Eftud2 A G 11: 102,851,747 probably benign Het
Eif4enif1 A G 11: 3,239,493 probably benign Het
Exoc3l2 T A 7: 19,491,784 probably benign Het
Fam118b T C 9: 35,223,673 S213G possibly damaging Het
Katnal1 G A 5: 148,894,251 A171V probably benign Het
Lrig3 A G 10: 125,997,076 N273S probably damaging Het
Lrriq1 G A 10: 103,071,129 R1577W probably benign Het
Olfr385 A C 11: 73,589,377 Y120* probably null Het
Olfr495 T A 7: 108,395,332 S71T probably benign Het
Pmel A G 10: 128,714,060 D30G probably benign Het
Ppp1r15a T C 7: 45,523,869 Y505C probably damaging Het
Prpf40b C T 15: 99,316,348 R830C probably benign Het
Rabgap1l A T 1: 160,738,909 D106E probably damaging Het
Rad18 C A 6: 112,649,664 E141* probably null Het
Ros1 C T 10: 52,098,870 V1540M probably damaging Het
Secisbp2 G A 13: 51,656,905 R201H probably damaging Het
Shisa6 A G 11: 66,220,010 S302P probably damaging Het
Slamf9 C A 1: 172,477,331 Q171K probably benign Het
Sox6 T A 7: 115,662,442 T180S probably damaging Het
Ttn T C 2: 76,723,654 S30902G possibly damaging Het
Xirp1 A G 9: 120,017,916 F634L possibly damaging Het
Yrdc T A 4: 124,854,536 S278T possibly damaging Het
Other mutations in Commd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Commd10 APN 18 46963668 missense probably benign
IGL03162:Commd10 APN 18 47087050 missense probably damaging 1.00
R0045:Commd10 UTSW 18 46967836 missense possibly damaging 0.52
R1735:Commd10 UTSW 18 46990485 missense probably benign 0.18
R2049:Commd10 UTSW 18 46963747 missense probably benign 0.03
R2135:Commd10 UTSW 18 46990537 missense possibly damaging 0.70
R5330:Commd10 UTSW 18 46960430 missense probably damaging 0.96
R5331:Commd10 UTSW 18 46960430 missense probably damaging 0.96
R6250:Commd10 UTSW 18 46963688 missense probably damaging 1.00
R7663:Commd10 UTSW 18 47086256 missense probably benign
R7994:Commd10 UTSW 18 46958919 missense possibly damaging 0.51
R8782:Commd10 UTSW 18 46963742 missense probably damaging 1.00
Z1176:Commd10 UTSW 18 46990566 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTTGACTGTTACTGTTGTGCC -3'
(R):5'- CCCTGATCCCTGAAAGCAATCTGAC -3'

Sequencing Primer
(F):5'- TGCCGTGTTATGCTGAGC -3'
(R):5'- ggagtgggagggttggg -3'
Posted On2014-01-15