Mutagenetix > Incidental Mutation

Incidental Mutation 'R1221:Kdm5b'

100041

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

039290-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R1221 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 134599091 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 317 (S317T)

Ref Sequence

ENSEMBL: ENSMUSP00000107817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

PDB Structure

Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000047714
AA Change: S317T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: S317T

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112197

SMART Domains

Protein: ENSMUSP00000107816
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	225	236	N/A	INTRINSIC
PHD	308	354	6.15e-14	SMART
JmjC	450	595	2.6e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112198
AA Change: S317T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: S317T

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,326,221	V255E	probably benign	Het
Aak1	T	C	6: 86,965,478	S668P	unknown	Het
Anks1	A	G	17: 28,050,642	Q770R	possibly damaging	Het
Apc2	G	A	10: 80,306,380	V378I	probably damaging	Het
Apeh	A	G	9: 108,092,609	V184A	probably benign	Het
AU018091	A	G	7: 3,158,877	F404S	probably damaging	Het
Bap1	T	C	14: 31,257,651	L537P	probably damaging	Het
Bhlha15	A	G	5: 144,191,523	Y151C	probably damaging	Het
Bmp8b	A	T	4: 123,114,711	T157S	probably damaging	Het
Btbd1	G	T	7: 81,818,257	H172N	possibly damaging	Het
C1rl	A	G	6: 124,493,981	R83G	probably benign	Het
Cep104	A	G	4: 153,988,445	T387A	probably benign	Het
Cfi	A	T	3: 129,872,969	Q447L	probably damaging	Het
Coq6	A	G	12: 84,371,527	E295G	possibly damaging	Het
Dclre1a	T	C	19: 56,531,268	T978A	possibly damaging	Het
Dlc1	T	C	8: 36,584,831	D582G	probably benign	Het
Dlgap2	A	G	8: 14,726,952	T65A	probably benign	Het
Dock5	G	A	14: 67,759,161	S1711L	probably benign	Het
Drc3	A	C	11: 60,384,226	I338L	probably benign	Het
Dsc1	A	T	18: 20,114,542	C5*	probably null	Het
F5	A	G	1: 164,161,799	Y90C	probably damaging	Het
Gdf10	G	A	14: 33,932,753	A406T	probably benign	Het
Gm136	G	T	4: 34,744,127	A239E	possibly damaging	Het
Gm4952	A	T	19: 12,623,695	D93V	possibly damaging	Het
Gramd1c	T	C	16: 43,989,864	T454A	possibly damaging	Het
Gstm6	A	G	3: 107,941,102	I58T	probably damaging	Het
Kdm3b	C	T	18: 34,808,245	S263L	possibly damaging	Het
Myo15b	A	G	11: 115,886,720	R71G	possibly damaging	Het
Nlrp1b	G	A	11: 71,181,464	P518S	probably benign	Het
Nme5	A	T	18: 34,571,522	I90N	probably damaging	Het
Nrxn1	T	A	17: 90,643,294	T478S	probably damaging	Het
Odf3	G	T	7: 140,848,383	W10L	probably damaging	Het
Olfr936	A	C	9: 39,047,187	D77E	probably damaging	Het
Osmr	G	A	15: 6,823,561	Q617*	probably null	Het
Pcsk5	T	C	19: 17,837,148	D2G	possibly damaging	Het
Pdpn	G	A	4: 143,274,038	R75C	probably damaging	Het
Pidd1	A	T	7: 141,438,812	F842Y	probably damaging	Het
Sema3a	A	G	5: 13,516,223	Q158R	probably benign	Het
Setbp1	T	A	18: 78,856,583	R1290W	probably damaging	Het
Slc20a1	G	A	2: 129,208,404	G494D	probably benign	Het
Spag17	A	G	3: 99,982,268	E151G	possibly damaging	Het
Stt3b	A	G	9: 115,257,499	F351L	probably benign	Het
Tas1r2	A	G	4: 139,669,125	M592V	probably benign	Het
Tbcd	A	G	11: 121,497,083	T347A	probably benign	Het
Tmem109	C	A	19: 10,874,369	R37L	possibly damaging	Het
Tmem67	G	A	4: 12,045,871	S862L	possibly damaging	Het
Ttn	T	A	2: 76,951,513	D1017V	probably damaging	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfyve16	T	C	13: 92,508,305	S1130G	possibly damaging	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R3983:Kdm5b	UTSW	1	134631304	missense	possibly damaging	0.91
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	possibly damaging	0.85
R9630:Kdm5b	UTSW	1	134585233	critical splice donor site	probably null
R9670:Kdm5b	UTSW	1	134630502	nonsense	probably null
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCAAGGTCTAAGGTCATCCTCC -3'
(R):5'- ACTGTGACAGATTCAAAGGTCCTGC -3'

Sequencing Primer
(F):5'- GGTCTAAGGTCATCCTCCACTAAG -3'
(R):5'- TACACTGAGGAACTTGGAAAGATTC -3'

Posted On

2014-01-15