Incidental Mutation 'R1177:Mast3'
ID100059
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 039249-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1177 (G1)
Quality Score222
Status Not validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70780324 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1115 (S1115P)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142370
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: S1131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S1131P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191396
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: S1115P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000212140
AA Change: S366P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15