Mutagenetix > Incidental Mutation

Incidental Mutation 'R1177:Mast3'

100059

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039249-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1177 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70780324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1115 (S1115P)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: S1131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: S1131P

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: S1115P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

unknown
Transcript: ENSMUST00000212140
AA Change: S366P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Coding Region Coverage

1x: 99.4%
3x: 98.3%
10x: 94.9%
20x: 87.7%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bbs7	A	T	3: 36,610,180		probably null	Het
Bivm	G	A	1: 44,142,963	V444I	probably benign	Het
Cers4	A	G	8: 4,516,931	I78V	probably null	Het
Chgb	A	G	2: 132,793,470	Y444C	possibly damaging	Het
Col7a1	T	C	9: 108,962,441	V1161A	unknown	Het
Dpp6	A	G	5: 27,663,473	D478G	possibly damaging	Het
Eif4enif1	T	C	11: 3,229,902	V274A	probably damaging	Het
Fkrp	T	C	7: 16,810,527	E470G	probably damaging	Het
Lrrc8c	T	C	5: 105,606,836	I159T	probably benign	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Map3k21	A	T	8: 125,944,838	Q955L	probably benign	Het
Mga	T	C	2: 119,926,446	F1048S	probably damaging	Het
Mthfd1l	A	C	10: 3,985,661	K212T	possibly damaging	Het
Myo5b	G	A	18: 74,644,072	R401H	probably damaging	Het
Naip1	C	T	13: 100,427,064	S531N	possibly damaging	Het
Nlrp1a	A	G	11: 71,107,721	V884A	probably damaging	Het
Nop58	T	A	1: 59,700,932	M161K	probably damaging	Het
Nrbp1	T	A	5: 31,245,813	I210N	probably damaging	Het
Nup210l	A	G	3: 90,202,003	T1618A	probably benign	Het
Olfr1202	A	G	2: 88,817,360	Y63C	probably benign	Het
Olfr124	A	T	17: 37,805,952	E269V	probably benign	Het
Olfr963	A	G	9: 39,669,641	R195G	probably benign	Het
Ppp4r4	G	A	12: 103,576,323	A115T	possibly damaging	Het
Rag1	T	C	2: 101,642,278	R840G	probably benign	Het
Slc44a2	A	T	9: 21,348,583	Q629L	probably benign	Het
Slc5a6	A	G	5: 31,039,302		probably null	Het
Spag1	A	T	15: 36,234,767	T859S	probably benign	Het
Sv2c	G	T	13: 95,989,763	A327E	possibly damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tlr2	A	G	3: 83,838,734	I14T	probably benign	Het
Trpc6	G	A	9: 8,658,304	R725K	probably benign	Het
Wdr90	A	G	17: 25,846,054	V1688A	possibly damaging	Het
Zfhx4	ACCTCCTCCTCCTCCTCCTCC	ACCTCCTCCTCCTCCTCC	3: 5,400,831		probably benign	Het
Zfp94	T	C	7: 24,303,528	Y163C	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

Posted On

2014-01-15