Incidental Mutation 'R1177:Slc44a2'
ID100065
Institutional Source Beutler Lab
Gene Symbol Slc44a2
Ensembl Gene ENSMUSG00000057193
Gene Namesolute carrier family 44, member 2
Synonyms1110028E10Rik, CTL2
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1177 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21320698-21355028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21348583 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 629 (Q629L)
Ref Sequence ENSEMBL: ENSMUSP00000034697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034697] [ENSMUST00000215574] [ENSMUST00000217461]
Predicted Effect probably benign
Transcript: ENSMUST00000034697
AA Change: Q629L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034697
Gene: ENSMUSG00000057193
AA Change: Q629L

DomainStartEndE-ValueType
Blast:CLECT 4 37 8e-8 BLAST
transmembrane domain 231 253 N/A INTRINSIC
transmembrane domain 255 277 N/A INTRINSIC
Pfam:Choline_transpo 319 678 3.9e-119 PFAM
low complexity region 691 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213499
Predicted Effect unknown
Transcript: ENSMUST00000213535
AA Change: Q27L
Predicted Effect unknown
Transcript: ENSMUST00000214268
AA Change: Q86L
Predicted Effect probably benign
Transcript: ENSMUST00000215574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217453
Predicted Effect probably benign
Transcript: ENSMUST00000217461
AA Change: Q627L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cochlear hair cell loss, spiral ganglion degeneration, and progressive sensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Wdr90 A G 17: 25,846,054 V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Slc44a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Slc44a2 APN 9 21345935 missense probably damaging 0.96
IGL01506:Slc44a2 APN 9 21337950 missense probably benign 0.30
IGL01687:Slc44a2 APN 9 21345947 missense probably benign 0.00
IGL01786:Slc44a2 APN 9 21352486 missense probably damaging 1.00
IGL01795:Slc44a2 APN 9 21345349 missense probably damaging 0.97
IGL02338:Slc44a2 APN 9 21347042 missense probably damaging 1.00
IGL02701:Slc44a2 APN 9 21347951 missense probably benign 0.01
IGL02820:Slc44a2 APN 9 21342977 missense probably benign
IGL03087:Slc44a2 APN 9 21346765 missense probably benign 0.00
IGL03153:Slc44a2 APN 9 21343200 missense probably benign 0.44
IGL03233:Slc44a2 APN 9 21348622 missense possibly damaging 0.95
R1367:Slc44a2 UTSW 9 21343026 missense probably benign 0.00
R1474:Slc44a2 UTSW 9 21353694 missense probably damaging 0.99
R2077:Slc44a2 UTSW 9 21353724 missense probably damaging 1.00
R2432:Slc44a2 UTSW 9 21344834 missense probably damaging 1.00
R3722:Slc44a2 UTSW 9 21342977 missense possibly damaging 0.78
R3958:Slc44a2 UTSW 9 21348541 missense probably damaging 0.96
R4557:Slc44a2 UTSW 9 21346783 missense possibly damaging 0.93
R4641:Slc44a2 UTSW 9 21346882 missense probably damaging 1.00
R4725:Slc44a2 UTSW 9 21348395 missense probably damaging 1.00
R4859:Slc44a2 UTSW 9 21348145 missense probably damaging 0.98
R6701:Slc44a2 UTSW 9 21320853 critical splice donor site probably null
R7068:Slc44a2 UTSW 9 21320848 missense probably benign 0.00
R7206:Slc44a2 UTSW 9 21346807 missense probably damaging 1.00
R7233:Slc44a2 UTSW 9 21348149 critical splice donor site probably null
R7287:Slc44a2 UTSW 9 21342456 missense probably benign
R7329:Slc44a2 UTSW 9 21342752 missense probably damaging 1.00
R7432:Slc44a2 UTSW 9 21343215 missense probably benign 0.00
R7442:Slc44a2 UTSW 9 21345523 missense probably damaging 1.00
R7448:Slc44a2 UTSW 9 21348346 missense possibly damaging 0.87
R7514:Slc44a2 UTSW 9 21342472 missense possibly damaging 0.46
R7523:Slc44a2 UTSW 9 21345992 missense probably null 0.81
X0018:Slc44a2 UTSW 9 21342788 missense probably damaging 0.99
Predicted Primers
Posted On2014-01-15