Incidental Mutation 'R1177:Sv2c'
ID 100083
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Name synaptic vesicle glycoprotein 2c
Synonyms 4930527L09Rik
MMRRC Submission 039249-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R1177 (G1)
Quality Score 114
Status Not validated
Chromosome 13
Chromosomal Location 96091102-96269085 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 96126271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 327 (A327E)
Ref Sequence ENSEMBL: ENSMUSP00000124473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
AlphaFold Q69ZS6
Predicted Effect possibly damaging
Transcript: ENSMUST00000161263
AA Change: A327E

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: A327E

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably benign
Transcript: ENSMUST00000182289
AA Change: A327E

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: A327E

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220740
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,664,329 (GRCm39) probably null Het
Bivm G A 1: 44,182,123 (GRCm39) V444I probably benign Het
Cers4 A G 8: 4,566,931 (GRCm39) I78V probably null Het
Chgb A G 2: 132,635,390 (GRCm39) Y444C possibly damaging Het
Col7a1 T C 9: 108,791,509 (GRCm39) V1161A unknown Het
Dpp6 A G 5: 27,868,471 (GRCm39) D478G possibly damaging Het
Eif4enif1 T C 11: 3,179,902 (GRCm39) V274A probably damaging Het
Fkrp T C 7: 16,544,452 (GRCm39) E470G probably damaging Het
Lrrc8c T C 5: 105,754,702 (GRCm39) I159T probably benign Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Map3k21 A T 8: 126,671,577 (GRCm39) Q955L probably benign Het
Mast3 A G 8: 71,232,968 (GRCm39) S1115P probably damaging Het
Mga T C 2: 119,756,927 (GRCm39) F1048S probably damaging Het
Mthfd1l A C 10: 3,935,661 (GRCm39) K212T possibly damaging Het
Myo5b G A 18: 74,777,143 (GRCm39) R401H probably damaging Het
Naip1 C T 13: 100,563,572 (GRCm39) S531N possibly damaging Het
Nlrp1a A G 11: 70,998,547 (GRCm39) V884A probably damaging Het
Nop58 T A 1: 59,740,091 (GRCm39) M161K probably damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Nup210l A G 3: 90,109,310 (GRCm39) T1618A probably benign Het
Or10d4 A G 9: 39,580,937 (GRCm39) R195G probably benign Het
Or2b4 A T 17: 38,116,843 (GRCm39) E269V probably benign Het
Or4c105 A G 2: 88,647,704 (GRCm39) Y63C probably benign Het
Ppp4r4 G A 12: 103,542,582 (GRCm39) A115T possibly damaging Het
Rag1 T C 2: 101,472,623 (GRCm39) R840G probably benign Het
Slc44a2 A T 9: 21,259,879 (GRCm39) Q629L probably benign Het
Slc5a6 A G 5: 31,196,646 (GRCm39) probably null Het
Spag1 A T 15: 36,234,913 (GRCm39) T859S probably benign Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Tlr2 A G 3: 83,746,041 (GRCm39) I14T probably benign Het
Trpc6 G A 9: 8,658,305 (GRCm39) R725K probably benign Het
Wdr90 A G 17: 26,065,028 (GRCm39) V1688A possibly damaging Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,465,891 (GRCm39) probably benign Het
Zfp94 T C 7: 24,002,953 (GRCm39) Y163C probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96,184,937 (GRCm39) missense probably damaging 1.00
IGL01313:Sv2c APN 13 96,224,797 (GRCm39) missense probably damaging 1.00
IGL02710:Sv2c APN 13 96,125,649 (GRCm39) missense probably damaging 0.99
IGL02990:Sv2c APN 13 96,224,886 (GRCm39) missense probably damaging 1.00
IGL03145:Sv2c APN 13 96,125,606 (GRCm39) missense probably damaging 1.00
D4043:Sv2c UTSW 13 96,224,989 (GRCm39) missense probably benign 0.27
R0390:Sv2c UTSW 13 96,225,216 (GRCm39) missense probably benign
R0849:Sv2c UTSW 13 96,126,319 (GRCm39) missense probably damaging 1.00
R0907:Sv2c UTSW 13 96,224,763 (GRCm39) missense probably damaging 1.00
R1840:Sv2c UTSW 13 96,118,352 (GRCm39) missense probably benign 0.08
R1865:Sv2c UTSW 13 96,113,283 (GRCm39) missense probably benign 0.29
R1959:Sv2c UTSW 13 96,113,153 (GRCm39) missense probably damaging 1.00
R2440:Sv2c UTSW 13 96,185,084 (GRCm39) missense probably damaging 1.00
R4007:Sv2c UTSW 13 96,123,341 (GRCm39) splice site probably benign
R4197:Sv2c UTSW 13 96,114,636 (GRCm39) missense probably damaging 1.00
R4697:Sv2c UTSW 13 96,122,526 (GRCm39) missense possibly damaging 0.64
R4719:Sv2c UTSW 13 96,123,319 (GRCm39) missense probably benign 0.21
R4822:Sv2c UTSW 13 96,122,457 (GRCm39) missense probably damaging 1.00
R5237:Sv2c UTSW 13 96,118,391 (GRCm39) missense possibly damaging 0.76
R5452:Sv2c UTSW 13 96,114,591 (GRCm39) missense probably damaging 1.00
R5531:Sv2c UTSW 13 96,097,886 (GRCm39) missense probably damaging 0.98
R5756:Sv2c UTSW 13 96,122,475 (GRCm39) missense probably benign
R5982:Sv2c UTSW 13 96,112,571 (GRCm39) nonsense probably null
R6220:Sv2c UTSW 13 96,113,134 (GRCm39) missense probably damaging 1.00
R6511:Sv2c UTSW 13 96,185,033 (GRCm39) missense probably benign 0.00
R6520:Sv2c UTSW 13 96,123,229 (GRCm39) missense probably benign
R7001:Sv2c UTSW 13 96,118,461 (GRCm39) missense probably benign 0.11
R7073:Sv2c UTSW 13 96,224,758 (GRCm39) missense probably damaging 1.00
R7116:Sv2c UTSW 13 96,113,152 (GRCm39) missense probably damaging 1.00
R7261:Sv2c UTSW 13 96,224,809 (GRCm39) missense probably damaging 1.00
R7374:Sv2c UTSW 13 96,125,644 (GRCm39) missense probably damaging 1.00
R7423:Sv2c UTSW 13 96,185,056 (GRCm39) missense probably benign 0.03
R7626:Sv2c UTSW 13 96,122,451 (GRCm39) missense probably benign 0.13
R7727:Sv2c UTSW 13 96,113,203 (GRCm39) missense possibly damaging 0.89
R7767:Sv2c UTSW 13 96,126,223 (GRCm39) missense probably damaging 1.00
R7818:Sv2c UTSW 13 96,123,328 (GRCm39) nonsense probably null
R7831:Sv2c UTSW 13 96,113,200 (GRCm39) missense probably damaging 1.00
R7991:Sv2c UTSW 13 96,224,797 (GRCm39) missense probably damaging 1.00
R8137:Sv2c UTSW 13 96,225,171 (GRCm39) missense probably damaging 0.96
R8254:Sv2c UTSW 13 96,225,073 (GRCm39) missense probably damaging 1.00
R9192:Sv2c UTSW 13 96,224,755 (GRCm39) missense probably benign 0.00
R9203:Sv2c UTSW 13 96,224,745 (GRCm39) nonsense probably null
R9278:Sv2c UTSW 13 96,112,589 (GRCm39) missense probably damaging 0.98
R9547:Sv2c UTSW 13 96,185,008 (GRCm39) missense probably benign 0.03
R9585:Sv2c UTSW 13 96,122,466 (GRCm39) missense probably benign
Z1176:Sv2c UTSW 13 96,112,605 (GRCm39) missense probably benign
Predicted Primers
Posted On 2014-01-15