Incidental Mutation 'R1177:Wdr90'
ID100089
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission 039249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1177 (G1)
Quality Score146
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25846054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1688 (V1688A)
Ref Sequence ENSEMBL: ENSMUSP00000135420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079461
AA Change: V1706A

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: V1706A

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176583
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176604
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect possibly damaging
Transcript: ENSMUST00000176923
AA Change: V1688A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: V1688A

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.3%
  • 10x: 94.9%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs7 A T 3: 36,610,180 probably null Het
Bivm G A 1: 44,142,963 V444I probably benign Het
Cers4 A G 8: 4,516,931 I78V probably null Het
Chgb A G 2: 132,793,470 Y444C possibly damaging Het
Col7a1 T C 9: 108,962,441 V1161A unknown Het
Dpp6 A G 5: 27,663,473 D478G possibly damaging Het
Eif4enif1 T C 11: 3,229,902 V274A probably damaging Het
Fkrp T C 7: 16,810,527 E470G probably damaging Het
Lrrc8c T C 5: 105,606,836 I159T probably benign Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k21 A T 8: 125,944,838 Q955L probably benign Het
Mast3 A G 8: 70,780,324 S1115P probably damaging Het
Mga T C 2: 119,926,446 F1048S probably damaging Het
Mthfd1l A C 10: 3,985,661 K212T possibly damaging Het
Myo5b G A 18: 74,644,072 R401H probably damaging Het
Naip1 C T 13: 100,427,064 S531N possibly damaging Het
Nlrp1a A G 11: 71,107,721 V884A probably damaging Het
Nop58 T A 1: 59,700,932 M161K probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nup210l A G 3: 90,202,003 T1618A probably benign Het
Olfr1202 A G 2: 88,817,360 Y63C probably benign Het
Olfr124 A T 17: 37,805,952 E269V probably benign Het
Olfr963 A G 9: 39,669,641 R195G probably benign Het
Ppp4r4 G A 12: 103,576,323 A115T possibly damaging Het
Rag1 T C 2: 101,642,278 R840G probably benign Het
Slc44a2 A T 9: 21,348,583 Q629L probably benign Het
Slc5a6 A G 5: 31,039,302 probably null Het
Spag1 A T 15: 36,234,767 T859S probably benign Het
Sv2c G T 13: 95,989,763 A327E possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tlr2 A G 3: 83,838,734 I14T probably benign Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Zfhx4 ACCTCCTCCTCCTCCTCCTCC ACCTCCTCCTCCTCCTCC 3: 5,400,831 probably benign Het
Zfp94 T C 7: 24,303,528 Y163C probably damaging Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5268:Wdr90 UTSW 17 25850845 missense probably damaging 1.00
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Predicted Primers
Posted On2014-01-15