Incidental Mutation 'R1221:Btbd1'
ID100090
Institutional Source Beutler Lab
Gene Symbol Btbd1
Ensembl Gene ENSMUSG00000025103
Gene NameBTB (POZ) domain containing 1
Synonyms
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81792074-81829431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81818257 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 172 (H172N)
Ref Sequence ENSEMBL: ENSMUSP00000026093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026093
AA Change: H172N

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026093
Gene: ENSMUSG00000025103
AA Change: H172N

DomainStartEndE-ValueType
low complexity region 5 45 N/A INTRINSIC
BTB 75 181 2.73e-22 SMART
BACK 186 294 8.02e-10 SMART
Pfam:PHR 339 487 2.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208566
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Btbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Btbd1 APN 7 81794307 splice site probably null
IGL01476:Btbd1 APN 7 81801049 nonsense probably null
IGL02261:Btbd1 APN 7 81805759 missense probably damaging 0.98
R0164:Btbd1 UTSW 7 81801003 missense probably benign 0.28
R0164:Btbd1 UTSW 7 81801003 missense probably benign 0.28
R0600:Btbd1 UTSW 7 81816006 missense probably damaging 1.00
R2159:Btbd1 UTSW 7 81801056 missense possibly damaging 0.94
R3961:Btbd1 UTSW 7 81818335 nonsense probably null
R4769:Btbd1 UTSW 7 81805810 missense probably benign 0.04
R7159:Btbd1 UTSW 7 81818209 missense probably benign 0.44
R7331:Btbd1 UTSW 7 81815972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCTGATTTCAGCTCTGTAAC -3'
(R):5'- TGCTTGTCTAAAACAATGCCGATTGTC -3'

Sequencing Primer
(F):5'- atttgcctgcctctgcc -3'
(R):5'- ATGCCGATTGTCTATTTGAATTTTCC -3'
Posted On2014-01-15