Mutagenetix > Incidental Mutations

Incidental Mutation 'R1221:Btbd1'

100090

Institutional Source

Beutler Lab

Gene Symbol

Btbd1

Ensembl Gene

ENSMUSG00000025103

Gene Name

BTB (POZ) domain containing 1

Synonyms

MMRRC Submission

039290-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R1221 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81792074-81829431 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 81818257 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 172 (H172N)

Ref Sequence

ENSEMBL: ENSMUSP00000026093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026093]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026093
AA Change: H172N

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000026093
Gene: ENSMUSG00000025103
AA Change: H172N

Domain	Start	End	E-Value	Type
low complexity region	5	45	N/A	INTRINSIC
BTB	75	181	2.73e-22	SMART
BACK	186	294	8.02e-10	SMART
Pfam:PHR	339	487	2.2e-54	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208178

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208566

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,326,221	V255E	probably benign	Het
Aak1	T	C	6: 86,965,478	S668P	unknown	Het
Anks1	A	G	17: 28,050,642	Q770R	possibly damaging	Het
Apc2	G	A	10: 80,306,380	V378I	probably damaging	Het
Apeh	A	G	9: 108,092,609	V184A	probably benign	Het
AU018091	A	G	7: 3,158,877	F404S	probably damaging	Het
Bap1	T	C	14: 31,257,651	L537P	probably damaging	Het
Bhlha15	A	G	5: 144,191,523	Y151C	probably damaging	Het
Bmp8b	A	T	4: 123,114,711	T157S	probably damaging	Het
C1rl	A	G	6: 124,493,981	R83G	probably benign	Het
Cep104	A	G	4: 153,988,445	T387A	probably benign	Het
Cfi	A	T	3: 129,872,969	Q447L	probably damaging	Het
Coq6	A	G	12: 84,371,527	E295G	possibly damaging	Het
Dclre1a	T	C	19: 56,531,268	T978A	possibly damaging	Het
Dlc1	T	C	8: 36,584,831	D582G	probably benign	Het
Dlgap2	A	G	8: 14,726,952	T65A	probably benign	Het
Dock5	G	A	14: 67,759,161	S1711L	probably benign	Het
Drc3	A	C	11: 60,384,226	I338L	probably benign	Het
Dsc1	A	T	18: 20,114,542	C5*	probably null	Het
F5	A	G	1: 164,161,799	Y90C	probably damaging	Het
Gdf10	G	A	14: 33,932,753	A406T	probably benign	Het
Gm136	G	T	4: 34,744,127	A239E	possibly damaging	Het
Gm4952	A	T	19: 12,623,695	D93V	possibly damaging	Het
Gramd1c	T	C	16: 43,989,864	T454A	possibly damaging	Het
Gstm6	A	G	3: 107,941,102	I58T	probably damaging	Het
Kdm3b	C	T	18: 34,808,245	S263L	possibly damaging	Het
Kdm5b	G	C	1: 134,599,091	S317T	probably damaging	Het
Myo15b	A	G	11: 115,886,720	R71G	possibly damaging	Het
Nlrp1b	G	A	11: 71,181,464	P518S	probably benign	Het
Nme5	A	T	18: 34,571,522	I90N	probably damaging	Het
Nrxn1	T	A	17: 90,643,294	T478S	probably damaging	Het
Odf3	G	T	7: 140,848,383	W10L	probably damaging	Het
Olfr936	A	C	9: 39,047,187	D77E	probably damaging	Het
Osmr	G	A	15: 6,823,561	Q617*	probably null	Het
Pcsk5	T	C	19: 17,837,148	D2G	possibly damaging	Het
Pdpn	G	A	4: 143,274,038	R75C	probably damaging	Het
Pidd1	A	T	7: 141,438,812	F842Y	probably damaging	Het
Sema3a	A	G	5: 13,516,223	Q158R	probably benign	Het
Setbp1	T	A	18: 78,856,583	R1290W	probably damaging	Het
Slc20a1	G	A	2: 129,208,404	G494D	probably benign	Het
Spag17	A	G	3: 99,982,268	E151G	possibly damaging	Het
Stt3b	A	G	9: 115,257,499	F351L	probably benign	Het
Tas1r2	A	G	4: 139,669,125	M592V	probably benign	Het
Tbcd	A	G	11: 121,497,083	T347A	probably benign	Het
Tmem109	C	A	19: 10,874,369	R37L	possibly damaging	Het
Tmem67	G	A	4: 12,045,871	S862L	possibly damaging	Het
Ttn	T	A	2: 76,951,513	D1017V	probably damaging	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfyve16	T	C	13: 92,508,305	S1130G	possibly damaging	Het

Other mutations in Btbd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Btbd1	APN	7	81794307	splice site	probably null
IGL01476:Btbd1	APN	7	81801049	nonsense	probably null
IGL02261:Btbd1	APN	7	81805759	missense	probably damaging	0.98
R0164:Btbd1	UTSW	7	81801003	missense	probably benign	0.28
R0164:Btbd1	UTSW	7	81801003	missense	probably benign	0.28
R0600:Btbd1	UTSW	7	81816006	missense	probably damaging	1.00
R2159:Btbd1	UTSW	7	81801056	missense	possibly damaging	0.94
R3961:Btbd1	UTSW	7	81818335	nonsense	probably null
R4769:Btbd1	UTSW	7	81805810	missense	probably benign	0.04
R7159:Btbd1	UTSW	7	81818209	missense	probably benign	0.44
R7331:Btbd1	UTSW	7	81815972	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTGATTTCAGCTCTGTAAC -3'
(R):5'- TGCTTGTCTAAAACAATGCCGATTGTC -3'

Sequencing Primer
(F):5'- atttgcctgcctctgcc -3'
(R):5'- ATGCCGATTGTCTATTTGAATTTTCC -3'

Posted On

2014-01-15