Incidental Mutation 'R1221:Odf3'
ID100098
Institutional Source Beutler Lab
Gene Symbol Odf3
Ensembl Gene ENSMUSG00000025482
Gene Nameouter dense fiber of sperm tails 3
Synonyms1700011O04Rik, SHIPPO1
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140847805-140851018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 140848383 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 10 (W10L)
Ref Sequence ENSEMBL: ENSMUSP00000026555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026555] [ENSMUST00000035300] [ENSMUST00000106049] [ENSMUST00000209690]
Predicted Effect probably damaging
Transcript: ENSMUST00000026555
AA Change: W10L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026555
Gene: ENSMUSG00000025482
AA Change: W10L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 25 59 3.8e-3 PFAM
Pfam:SHIPPO-rpt 65 95 7.8e-2 PFAM
Pfam:SHIPPO-rpt 100 131 1.2e-7 PFAM
Pfam:SHIPPO-rpt 136 170 3.9e-4 PFAM
Pfam:SHIPPO-rpt 179 209 3e-4 PFAM
Pfam:SHIPPO-rpt 215 245 9.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035300
SMART Domains Protein: ENSMUSP00000048722
Gene: ENSMUSG00000038801

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 30 91 1.66e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106049
AA Change: W36L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101664
Gene: ENSMUSG00000025482
AA Change: W36L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 126 157 9.4e-6 PFAM
Pfam:SHIPPO-rpt 162 196 1e-3 PFAM
Pfam:SHIPPO-rpt 241 271 7.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190581
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Odf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0051:Odf3 UTSW 7 140850221 unclassified probably benign
R0547:Odf3 UTSW 7 140848815 splice site probably null
R0981:Odf3 UTSW 7 140848295 missense probably benign 0.00
R2849:Odf3 UTSW 7 140849269 missense probably benign 0.00
R4833:Odf3 UTSW 7 140848278 start codon destroyed probably null
R4854:Odf3 UTSW 7 140849462 missense probably damaging 1.00
R4896:Odf3 UTSW 7 140848485 intron probably benign
R5109:Odf3 UTSW 7 140849548 missense probably benign 0.11
R6110:Odf3 UTSW 7 140848641 missense possibly damaging 0.73
R6354:Odf3 UTSW 7 140850614 splice site probably null
R6441:Odf3 UTSW 7 140849248 missense probably damaging 1.00
R6516:Odf3 UTSW 7 140848805 missense probably damaging 0.99
R6672:Odf3 UTSW 7 140848427 missense probably benign 0.27
R7086:Odf3 UTSW 7 140849489 missense probably benign
R7820:Odf3 UTSW 7 140849263 missense probably benign 0.44
R8069:Odf3 UTSW 7 140850302 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGAAGGCATGACTCCCACCCTTATC -3'
(R):5'- AGGATTAAGCCCAGATCCATCCCAG -3'

Sequencing Primer
(F):5'- CACCCTTATCTTGGAGCTGG -3'
(R):5'- AGCCCACAGCAATCTTGG -3'
Posted On2014-01-15