Incidental Mutation 'R1221:Coq6'
ID100127
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1221 (G1)
Quality Score197
Status Not validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84371527 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 295 (E295G)
Ref Sequence ENSEMBL: ENSMUSP00000105907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000120942] [ENSMUST00000152913]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021661
AA Change: E295G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235
AA Change: E295G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021662
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072061
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110272
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110276
AA Change: E295G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235
AA Change: E295G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110278
AA Change: E295G

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235
AA Change: E295G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120942
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Dock5 G A 14: 67,759,161 S1711L probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0508:Coq6 UTSW 12 84368139 splice site probably benign
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGCTTTCAGAACTGTCCCCAGG -3'
(R):5'- ACTGCACCAAAGGTGCTATGCTATG -3'

Sequencing Primer
(F):5'- ACAGCTCTCGGATACCTTGA -3'
(R):5'- GGGATGTATACTAAATGACCCATGC -3'
Posted On2014-01-15