Mutagenetix > Incidental Mutation

Incidental Mutation 'R1221:Dock5'

100139

Institutional Source

Beutler Lab

Gene Symbol

Dock5

Ensembl Gene

ENSMUSG00000044447

Gene Name

dedicator of cytokinesis 5

Synonyms

lr2, 1110060D06Rik, rlc

MMRRC Submission

039290-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.234) question?

Stock #

R1221 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67752135-67933442 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 67759161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 1711 (S1711L)

Ref Sequence

ENSEMBL: ENSMUSP00000036674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039135]

AlphaFold

B2RY04

Predicted Effect

probably benign
Transcript: ENSMUST00000039135
AA Change: S1711L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: S1711L

Domain	Start	End	E-Value	Type
SH3	11	68	1.45e-13	SMART
Pfam:DOCK_N	71	434	9e-110	PFAM
Pfam:DOCK-C2	439	636	1.1e-57	PFAM
low complexity region	752	764	N/A	INTRINSIC
Pfam:DHR-2	1133	1635	6.4e-99	PFAM
low complexity region	1663	1692	N/A	INTRINSIC
low complexity region	1815	1824	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226033

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,326,221	V255E	probably benign	Het
Aak1	T	C	6: 86,965,478	S668P	unknown	Het
Anks1	A	G	17: 28,050,642	Q770R	possibly damaging	Het
Apc2	G	A	10: 80,306,380	V378I	probably damaging	Het
Apeh	A	G	9: 108,092,609	V184A	probably benign	Het
AU018091	A	G	7: 3,158,877	F404S	probably damaging	Het
Bap1	T	C	14: 31,257,651	L537P	probably damaging	Het
Bhlha15	A	G	5: 144,191,523	Y151C	probably damaging	Het
Bmp8b	A	T	4: 123,114,711	T157S	probably damaging	Het
Btbd1	G	T	7: 81,818,257	H172N	possibly damaging	Het
C1rl	A	G	6: 124,493,981	R83G	probably benign	Het
Cep104	A	G	4: 153,988,445	T387A	probably benign	Het
Cfi	A	T	3: 129,872,969	Q447L	probably damaging	Het
Coq6	A	G	12: 84,371,527	E295G	possibly damaging	Het
Dclre1a	T	C	19: 56,531,268	T978A	possibly damaging	Het
Dlc1	T	C	8: 36,584,831	D582G	probably benign	Het
Dlgap2	A	G	8: 14,726,952	T65A	probably benign	Het
Drc3	A	C	11: 60,384,226	I338L	probably benign	Het
Dsc1	A	T	18: 20,114,542	C5*	probably null	Het
F5	A	G	1: 164,161,799	Y90C	probably damaging	Het
Gdf10	G	A	14: 33,932,753	A406T	probably benign	Het
Gm136	G	T	4: 34,744,127	A239E	possibly damaging	Het
Gm4952	A	T	19: 12,623,695	D93V	possibly damaging	Het
Gramd1c	T	C	16: 43,989,864	T454A	possibly damaging	Het
Gstm6	A	G	3: 107,941,102	I58T	probably damaging	Het
Kdm3b	C	T	18: 34,808,245	S263L	possibly damaging	Het
Kdm5b	G	C	1: 134,599,091	S317T	probably damaging	Het
Myo15b	A	G	11: 115,886,720	R71G	possibly damaging	Het
Nlrp1b	G	A	11: 71,181,464	P518S	probably benign	Het
Nme5	A	T	18: 34,571,522	I90N	probably damaging	Het
Nrxn1	T	A	17: 90,643,294	T478S	probably damaging	Het
Odf3	G	T	7: 140,848,383	W10L	probably damaging	Het
Olfr936	A	C	9: 39,047,187	D77E	probably damaging	Het
Osmr	G	A	15: 6,823,561	Q617*	probably null	Het
Pcsk5	T	C	19: 17,837,148	D2G	possibly damaging	Het
Pdpn	G	A	4: 143,274,038	R75C	probably damaging	Het
Pidd1	A	T	7: 141,438,812	F842Y	probably damaging	Het
Sema3a	A	G	5: 13,516,223	Q158R	probably benign	Het
Setbp1	T	A	18: 78,856,583	R1290W	probably damaging	Het
Slc20a1	G	A	2: 129,208,404	G494D	probably benign	Het
Spag17	A	G	3: 99,982,268	E151G	possibly damaging	Het
Stt3b	A	G	9: 115,257,499	F351L	probably benign	Het
Tas1r2	A	G	4: 139,669,125	M592V	probably benign	Het
Tbcd	A	G	11: 121,497,083	T347A	probably benign	Het
Tmem109	C	A	19: 10,874,369	R37L	possibly damaging	Het
Tmem67	G	A	4: 12,045,871	S862L	possibly damaging	Het
Ttn	T	A	2: 76,951,513	D1017V	probably damaging	Het
Zfp646	G	A	7: 127,883,120	G1490S	probably benign	Het
Zfyve16	T	C	13: 92,508,305	S1130G	possibly damaging	Het

Other mutations in Dock5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Dock5	APN	14	67786889	splice site	probably benign
IGL00930:Dock5	APN	14	67771077	missense	probably damaging	1.00
IGL01525:Dock5	APN	14	67805720	splice site	probably benign
IGL01759:Dock5	APN	14	67881259	nonsense	probably null
IGL01941:Dock5	APN	14	67812232	missense	probably damaging	1.00
IGL02025:Dock5	APN	14	67763287	missense	probably damaging	1.00
IGL02093:Dock5	APN	14	67839543	splice site	probably benign
IGL02179:Dock5	APN	14	67806496	splice site	probably benign
IGL02208:Dock5	APN	14	67828450	missense	probably benign	0.06
IGL02605:Dock5	APN	14	67828438	missense	probably benign	0.18
IGL02608:Dock5	APN	14	67828439	missense	probably benign	0.01
IGL02938:Dock5	APN	14	67757218	splice site	probably benign
IGL02971:Dock5	APN	14	67757109	missense	probably null	1.00
IGL02983:Dock5	APN	14	67764670	missense	probably damaging	1.00
IGL03151:Dock5	APN	14	67866067	missense	probably damaging	1.00
IGL03410:Dock5	APN	14	67846086	missense	probably benign	0.04
PIT4366001:Dock5	UTSW	14	67824674	missense	possibly damaging	0.83
R0026:Dock5	UTSW	14	67846081	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0058:Dock5	UTSW	14	67781036	missense	probably benign	0.00
R0112:Dock5	UTSW	14	67819641	missense	probably benign
R0127:Dock5	UTSW	14	67846042	missense	probably benign	0.13
R0144:Dock5	UTSW	14	67786286	missense	probably benign	0.18
R0312:Dock5	UTSW	14	67795991	missense	possibly damaging	0.82
R0360:Dock5	UTSW	14	67822680	splice site	probably benign
R0364:Dock5	UTSW	14	67822680	splice site	probably benign
R0496:Dock5	UTSW	14	67817518	missense	probably damaging	1.00
R0506:Dock5	UTSW	14	67784792	splice site	probably benign
R0586:Dock5	UTSW	14	67809032	missense	probably damaging	1.00
R0597:Dock5	UTSW	14	67784934	splice site	probably null
R0625:Dock5	UTSW	14	67841163	missense	probably benign
R1109:Dock5	UTSW	14	67806478	missense	possibly damaging	0.80
R1278:Dock5	UTSW	14	67839566	missense	possibly damaging	0.80
R1927:Dock5	UTSW	14	67846062	missense	possibly damaging	0.60
R1944:Dock5	UTSW	14	67757135	nonsense	probably null
R1946:Dock5	UTSW	14	67786316	missense	probably damaging	1.00
R2046:Dock5	UTSW	14	67812142	missense	probably benign
R2101:Dock5	UTSW	14	67794010	missense	probably benign	0.02
R2252:Dock5	UTSW	14	67784812	missense	probably damaging	0.98
R2882:Dock5	UTSW	14	67839620	missense	probably damaging	0.99
R3110:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R3112:Dock5	UTSW	14	67857922	missense	possibly damaging	0.72
R4236:Dock5	UTSW	14	67756492	missense	probably benign	0.02
R4242:Dock5	UTSW	14	67828490	missense	probably benign	0.19
R4244:Dock5	UTSW	14	67774582	missense	probably benign	0.41
R4646:Dock5	UTSW	14	67842779	missense	probably benign	0.01
R4793:Dock5	UTSW	14	67800354	missense	probably benign	0.26
R4841:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R4842:Dock5	UTSW	14	67817563	missense	probably damaging	0.98
R5159:Dock5	UTSW	14	67792289	missense	probably benign	0.04
R5164:Dock5	UTSW	14	67817661	nonsense	probably null
R5206:Dock5	UTSW	14	67763184	missense	probably benign	0.35
R5207:Dock5	UTSW	14	67776284	missense	probably benign	0.06
R5322:Dock5	UTSW	14	67770266	missense	probably benign	0.41
R5374:Dock5	UTSW	14	67805756	missense	possibly damaging	0.81
R5413:Dock5	UTSW	14	67764655	missense	probably damaging	1.00
R5476:Dock5	UTSW	14	67814007	missense	possibly damaging	0.92
R5504:Dock5	UTSW	14	67803086	missense	probably benign	0.01
R5677:Dock5	UTSW	14	67777603	missense	probably benign	0.00
R5773:Dock5	UTSW	14	67796058	missense	possibly damaging	0.95
R5845:Dock5	UTSW	14	67841101	missense	possibly damaging	0.82
R5957:Dock5	UTSW	14	67857994	missense	probably benign
R6154:Dock5	UTSW	14	67859912	missense	probably benign	0.03
R6268:Dock5	UTSW	14	67790275	nonsense	probably null
R6393:Dock5	UTSW	14	67822602	missense	probably benign	0.32
R6512:Dock5	UTSW	14	67824648	missense	possibly damaging	0.93
R6759:Dock5	UTSW	14	67795996	missense	probably benign	0.00
R7012:Dock5	UTSW	14	67822586	missense	probably damaging	1.00
R7061:Dock5	UTSW	14	67770254	missense	probably damaging	0.96
R7196:Dock5	UTSW	14	67756470	missense	probably damaging	1.00
R7200:Dock5	UTSW	14	67771702	nonsense	probably null
R7311:Dock5	UTSW	14	67828502	missense	probably benign	0.25
R7359:Dock5	UTSW	14	67765888	missense	probably benign	0.10
R7422:Dock5	UTSW	14	67809030	missense	probably benign	0.01
R7588:Dock5	UTSW	14	67763158	critical splice donor site	probably null
R7637:Dock5	UTSW	14	67786340	missense	possibly damaging	0.95
R7709:Dock5	UTSW	14	67796005	missense	probably benign	0.44
R7763:Dock5	UTSW	14	67821327	missense	probably damaging	0.97
R8044:Dock5	UTSW	14	67824692	missense	probably damaging	1.00
R8076:Dock5	UTSW	14	67802977	splice site	probably null
R8168:Dock5	UTSW	14	67770197	splice site	probably null
R8353:Dock5	UTSW	14	67817508	splice site	probably null
R8480:Dock5	UTSW	14	67836410	missense	probably benign	0.32
R8535:Dock5	UTSW	14	67793976	missense	probably benign	0.19
R8708:Dock5	UTSW	14	67767371	missense	probably benign	0.02
R8732:Dock5	UTSW	14	67846000	missense	possibly damaging	0.85
R8888:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8895:Dock5	UTSW	14	67817663	missense	possibly damaging	0.95
R8936:Dock5	UTSW	14	67845990	nonsense	probably null
R8962:Dock5	UTSW	14	67757191	missense	probably benign
R8972:Dock5	UTSW	14	67776300	missense	probably damaging	1.00
R9244:Dock5	UTSW	14	67759114	missense	probably damaging	0.99
R9345:Dock5	UTSW	14	67822622	missense	possibly damaging	0.74
R9679:Dock5	UTSW	14	67781001	missense	probably damaging	1.00
X0023:Dock5	UTSW	14	67771088	missense	probably benign	0.15
Z1177:Dock5	UTSW	14	67813933	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGACTTGAGCCTCTCTGTCTATGCG -3'
(R):5'- AGACTCTGGGAACCTGAGAAGTTGG -3'

Sequencing Primer
(F):5'- ccttccttccttctttccctc -3'
(R):5'- CCTGAGAAGTTGGGTGAAGATG -3'

Posted On

2014-01-15