Incidental Mutation 'R1221:Dock5'
ID100139
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Namededicator of cytokinesis 5
Synonymslr2, 1110060D06Rik, rlc
MMRRC Submission 039290-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R1221 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67752135-67933442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67759161 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1711 (S1711L)
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
Predicted Effect probably benign
Transcript: ENSMUST00000039135
AA Change: S1711L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447
AA Change: S1711L

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,326,221 V255E probably benign Het
Aak1 T C 6: 86,965,478 S668P unknown Het
Anks1 A G 17: 28,050,642 Q770R possibly damaging Het
Apc2 G A 10: 80,306,380 V378I probably damaging Het
Apeh A G 9: 108,092,609 V184A probably benign Het
AU018091 A G 7: 3,158,877 F404S probably damaging Het
Bap1 T C 14: 31,257,651 L537P probably damaging Het
Bhlha15 A G 5: 144,191,523 Y151C probably damaging Het
Bmp8b A T 4: 123,114,711 T157S probably damaging Het
Btbd1 G T 7: 81,818,257 H172N possibly damaging Het
C1rl A G 6: 124,493,981 R83G probably benign Het
Cep104 A G 4: 153,988,445 T387A probably benign Het
Cfi A T 3: 129,872,969 Q447L probably damaging Het
Coq6 A G 12: 84,371,527 E295G possibly damaging Het
Dclre1a T C 19: 56,531,268 T978A possibly damaging Het
Dlc1 T C 8: 36,584,831 D582G probably benign Het
Dlgap2 A G 8: 14,726,952 T65A probably benign Het
Drc3 A C 11: 60,384,226 I338L probably benign Het
Dsc1 A T 18: 20,114,542 C5* probably null Het
F5 A G 1: 164,161,799 Y90C probably damaging Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm136 G T 4: 34,744,127 A239E possibly damaging Het
Gm4952 A T 19: 12,623,695 D93V possibly damaging Het
Gramd1c T C 16: 43,989,864 T454A possibly damaging Het
Gstm6 A G 3: 107,941,102 I58T probably damaging Het
Kdm3b C T 18: 34,808,245 S263L possibly damaging Het
Kdm5b G C 1: 134,599,091 S317T probably damaging Het
Myo15b A G 11: 115,886,720 R71G possibly damaging Het
Nlrp1b G A 11: 71,181,464 P518S probably benign Het
Nme5 A T 18: 34,571,522 I90N probably damaging Het
Nrxn1 T A 17: 90,643,294 T478S probably damaging Het
Odf3 G T 7: 140,848,383 W10L probably damaging Het
Olfr936 A C 9: 39,047,187 D77E probably damaging Het
Osmr G A 15: 6,823,561 Q617* probably null Het
Pcsk5 T C 19: 17,837,148 D2G possibly damaging Het
Pdpn G A 4: 143,274,038 R75C probably damaging Het
Pidd1 A T 7: 141,438,812 F842Y probably damaging Het
Sema3a A G 5: 13,516,223 Q158R probably benign Het
Setbp1 T A 18: 78,856,583 R1290W probably damaging Het
Slc20a1 G A 2: 129,208,404 G494D probably benign Het
Spag17 A G 3: 99,982,268 E151G possibly damaging Het
Stt3b A G 9: 115,257,499 F351L probably benign Het
Tas1r2 A G 4: 139,669,125 M592V probably benign Het
Tbcd A G 11: 121,497,083 T347A probably benign Het
Tmem109 C A 19: 10,874,369 R37L possibly damaging Het
Tmem67 G A 4: 12,045,871 S862L possibly damaging Het
Ttn T A 2: 76,951,513 D1017V probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zfyve16 T C 13: 92,508,305 S1130G possibly damaging Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67786889 splice site probably benign
IGL00930:Dock5 APN 14 67771077 missense probably damaging 1.00
IGL01525:Dock5 APN 14 67805720 splice site probably benign
IGL01759:Dock5 APN 14 67881259 nonsense probably null
IGL01941:Dock5 APN 14 67812232 missense probably damaging 1.00
IGL02025:Dock5 APN 14 67763287 missense probably damaging 1.00
IGL02093:Dock5 APN 14 67839543 splice site probably benign
IGL02179:Dock5 APN 14 67806496 splice site probably benign
IGL02208:Dock5 APN 14 67828450 missense probably benign 0.06
IGL02605:Dock5 APN 14 67828438 missense probably benign 0.18
IGL02608:Dock5 APN 14 67828439 missense probably benign 0.01
IGL02938:Dock5 APN 14 67757218 splice site probably benign
IGL02971:Dock5 APN 14 67757109 missense probably null 1.00
IGL02983:Dock5 APN 14 67764670 missense probably damaging 1.00
IGL03151:Dock5 APN 14 67866067 missense probably damaging 1.00
IGL03410:Dock5 APN 14 67846086 missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67824674 missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67846081 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0058:Dock5 UTSW 14 67781036 missense probably benign 0.00
R0112:Dock5 UTSW 14 67819641 missense probably benign
R0127:Dock5 UTSW 14 67846042 missense probably benign 0.13
R0144:Dock5 UTSW 14 67786286 missense probably benign 0.18
R0312:Dock5 UTSW 14 67795991 missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67822680 splice site probably benign
R0364:Dock5 UTSW 14 67822680 splice site probably benign
R0496:Dock5 UTSW 14 67817518 missense probably damaging 1.00
R0506:Dock5 UTSW 14 67784792 splice site probably benign
R0586:Dock5 UTSW 14 67809032 missense probably damaging 1.00
R0597:Dock5 UTSW 14 67784934 splice site probably null
R0625:Dock5 UTSW 14 67841163 missense probably benign
R1109:Dock5 UTSW 14 67806478 missense possibly damaging 0.80
R1278:Dock5 UTSW 14 67839566 missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67846062 missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67757135 nonsense probably null
R1946:Dock5 UTSW 14 67786316 missense probably damaging 1.00
R2046:Dock5 UTSW 14 67812142 missense probably benign
R2101:Dock5 UTSW 14 67794010 missense probably benign 0.02
R2252:Dock5 UTSW 14 67784812 missense probably damaging 0.98
R2882:Dock5 UTSW 14 67839620 missense probably damaging 0.99
R3110:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67857922 missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67756492 missense probably benign 0.02
R4242:Dock5 UTSW 14 67828490 missense probably benign 0.19
R4244:Dock5 UTSW 14 67774582 missense probably benign 0.41
R4646:Dock5 UTSW 14 67842779 missense probably benign 0.01
R4793:Dock5 UTSW 14 67800354 missense probably benign 0.26
R4841:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R4842:Dock5 UTSW 14 67817563 missense probably damaging 0.98
R5159:Dock5 UTSW 14 67792289 missense probably benign 0.04
R5164:Dock5 UTSW 14 67817661 nonsense probably null
R5206:Dock5 UTSW 14 67763184 missense probably benign 0.35
R5207:Dock5 UTSW 14 67776284 missense probably benign 0.06
R5322:Dock5 UTSW 14 67770266 missense probably benign 0.41
R5374:Dock5 UTSW 14 67805756 missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67764655 missense probably damaging 1.00
R5476:Dock5 UTSW 14 67814007 missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67803086 missense probably benign 0.01
R5677:Dock5 UTSW 14 67777603 missense probably benign 0.00
R5773:Dock5 UTSW 14 67796058 missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67841101 missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67857994 missense probably benign
R6154:Dock5 UTSW 14 67859912 missense probably benign 0.03
R6268:Dock5 UTSW 14 67790275 nonsense probably null
R6393:Dock5 UTSW 14 67822602 missense probably benign 0.32
R6512:Dock5 UTSW 14 67824648 missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67795996 missense probably benign 0.00
R7012:Dock5 UTSW 14 67822586 missense probably damaging 1.00
R7061:Dock5 UTSW 14 67770254 missense probably damaging 0.96
R7196:Dock5 UTSW 14 67756470 missense probably damaging 1.00
R7200:Dock5 UTSW 14 67771702 nonsense probably null
R7311:Dock5 UTSW 14 67828502 missense probably benign 0.25
R7359:Dock5 UTSW 14 67765888 missense probably benign 0.10
R7422:Dock5 UTSW 14 67809030 missense probably benign 0.01
R7588:Dock5 UTSW 14 67763158 critical splice donor site probably null
R7637:Dock5 UTSW 14 67786340 missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67796005 missense probably benign 0.44
R7763:Dock5 UTSW 14 67821327 missense probably damaging 0.97
R8044:Dock5 UTSW 14 67824692 missense probably damaging 1.00
R8076:Dock5 UTSW 14 67802977 splice site probably null
R8168:Dock5 UTSW 14 67770197 splice site probably null
R8353:Dock5 UTSW 14 67817508 splice site probably null
R8480:Dock5 UTSW 14 67836410 missense probably benign 0.32
R8535:Dock5 UTSW 14 67793976 missense probably benign 0.19
R8708:Dock5 UTSW 14 67767371 missense probably benign 0.02
R8732:Dock5 UTSW 14 67846000 missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67817663 missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67845990 nonsense probably null
R8962:Dock5 UTSW 14 67757191 missense probably benign
X0023:Dock5 UTSW 14 67771088 missense probably benign 0.15
Z1177:Dock5 UTSW 14 67813933 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACTTGAGCCTCTCTGTCTATGCG -3'
(R):5'- AGACTCTGGGAACCTGAGAAGTTGG -3'

Sequencing Primer
(F):5'- ccttccttccttctttccctc -3'
(R):5'- CCTGAGAAGTTGGGTGAAGATG -3'
Posted On2014-01-15