Incidental Mutation 'R1202:Gle1'
ID100174
Institutional Source Beutler Lab
Gene Symbol Gle1
Ensembl Gene ENSMUSG00000019715
Gene NameGLE1 RNA export mediator (yeast)
Synonyms4933405K21Rik
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29935426-29960371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29949265 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 523 (A523V)
Ref Sequence ENSEMBL: ENSMUSP00000019859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019859]
Predicted Effect probably damaging
Transcript: ENSMUST00000019859
AA Change: A523V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: A523V

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
coiled coil region 154 275 N/A INTRINSIC
coiled coil region 306 356 N/A INTRINSIC
Pfam:GLE1 397 650 2.4e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149730
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Gle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Gle1 APN 2 29939289 splice site probably benign
IGL01880:Gle1 APN 2 29943750 missense possibly damaging 0.53
IGL02293:Gle1 APN 2 29957760 missense probably benign 0.00
IGL02859:Gle1 APN 2 29949228 missense probably damaging 1.00
IGL03368:Gle1 APN 2 29943793 missense probably damaging 1.00
R0535:Gle1 UTSW 2 29957805 missense probably damaging 1.00
R0608:Gle1 UTSW 2 29940228 missense probably benign 0.01
R0839:Gle1 UTSW 2 29958450 missense probably benign 0.28
R0908:Gle1 UTSW 2 29936121 missense probably benign 0.06
R1102:Gle1 UTSW 2 29944054 missense possibly damaging 0.88
R1302:Gle1 UTSW 2 29952552 splice site probably null
R2184:Gle1 UTSW 2 29949018 missense probably damaging 1.00
R2213:Gle1 UTSW 2 29949301 missense probably damaging 0.97
R4151:Gle1 UTSW 2 29944044 missense probably damaging 1.00
R4172:Gle1 UTSW 2 29938526 missense probably benign
R4732:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4733:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4775:Gle1 UTSW 2 29936061 missense possibly damaging 0.86
R4817:Gle1 UTSW 2 29936211 missense probably benign 0.00
R4824:Gle1 UTSW 2 29940203 missense possibly damaging 0.82
R4869:Gle1 UTSW 2 29936020 missense possibly damaging 0.69
R4909:Gle1 UTSW 2 29936080 missense probably benign 0.01
R5036:Gle1 UTSW 2 29936211 missense probably benign 0.00
R5298:Gle1 UTSW 2 29948943 missense probably benign 0.02
R5903:Gle1 UTSW 2 29940281 missense probably benign 0.00
R6345:Gle1 UTSW 2 29936115 missense probably benign 0.00
R6529:Gle1 UTSW 2 29935527 missense possibly damaging 0.56
R7144:Gle1 UTSW 2 29943793 missense probably damaging 1.00
R7984:Gle1 UTSW 2 29938576 missense probably damaging 0.99
R8154:Gle1 UTSW 2 29938607 critical splice donor site probably null
R8203:Gle1 UTSW 2 29935510 missense probably benign
R8348:Gle1 UTSW 2 29942544 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCCCGTCCAGGTTCAAAGCTGAAGG -3'
(R):5'- TGCAGGCAAGAGTGAGAACACATCC -3'

Sequencing Primer
(F):5'- GACTTTGTCCAGTACAAACTGGC -3'
(R):5'- GTGAGAACACATCCCTATTCTTATGC -3'
Posted On2014-01-15