Incidental Mutation 'R1202:Hoxd11'
ID100178
Institutional Source Beutler Lab
Gene Symbol Hoxd11
Ensembl Gene ENSMUSG00000042499
Gene Namehomeobox D11
SynonymsHox-5.4, Hox-4.6, E230017H14Rik, Hox-5.5
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R1202 (G1)
Quality Score81
Status Not validated
Chromosome2
Chromosomal Location74679557-74687016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74682577 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 62 (A62V)
Ref Sequence ENSEMBL: ENSMUSP00000122582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001878] [ENSMUST00000142312]
Predicted Effect probably benign
Transcript: ENSMUST00000001878
SMART Domains Protein: ENSMUSP00000001878
Gene: ENSMUSG00000001823

DomainStartEndE-ValueType
HOX 200 262 4.57e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect possibly damaging
Transcript: ENSMUST00000142312
AA Change: A62V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122582
Gene: ENSMUSG00000042499
AA Change: A62V

DomainStartEndE-ValueType
Pfam:DUF3528 26 80 5.4e-25 PFAM
Pfam:DUF3528 103 198 7.1e-21 PFAM
low complexity region 224 257 N/A INTRINSIC
HOX 264 326 1.58e-24 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The product of the mouse Hoxd11 gene plays a role in forelimb morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations of sacral vertebrae, malformations of distal limbs, and reduced fertility in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Hoxd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Hoxd11 APN 2 74684041 missense probably damaging 1.00
R3895:Hoxd11 UTSW 2 74682792 missense probably damaging 0.99
R3935:Hoxd11 UTSW 2 74684032 missense probably benign 0.28
R5386:Hoxd11 UTSW 2 74682819 nonsense probably null
R7322:Hoxd11 UTSW 2 74684011 missense probably damaging 1.00
R7476:Hoxd11 UTSW 2 74684115 missense probably damaging 0.96
R8060:Hoxd11 UTSW 2 74682376 start gained probably benign
R8188:Hoxd11 UTSW 2 74683954 missense probably damaging 1.00
R8315:Hoxd11 UTSW 2 74683122 missense probably benign 0.00
R8697:Hoxd11 UTSW 2 74682669 missense unknown
R8875:Hoxd11 UTSW 2 74683021 missense probably benign 0.00
Z1177:Hoxd11 UTSW 2 74682415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATGAACGACTTTGACGAGTG -3'
(R):5'- GCCTCGTAGAACTGATCAAAGCCC -3'

Sequencing Primer
(F):5'- TTTGACGAGTGCGGCCC -3'
(R):5'- CTTGAAGAGCACGTCTggc -3'
Posted On2014-01-15