Incidental Mutation 'R1202:Pabpc1l'
ID100180
Institutional Source Beutler Lab
Gene Symbol Pabpc1l
Ensembl Gene ENSMUSG00000054582
Gene Namepoly(A) binding protein, cytoplasmic 1-like
Synonyms1810053B01Rik, ePAB
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164025450-164050538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 164037171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 313 (V313F)
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067715
AA Change: V313F

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582
AA Change: V313F

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156087
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Pabpc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pabpc1l APN 2 164042317 missense probably damaging 1.00
IGL00911:Pabpc1l APN 2 164042423 missense probably damaging 1.00
IGL02096:Pabpc1l APN 2 164044347 missense probably benign 0.00
IGL02198:Pabpc1l APN 2 164027616 missense probably damaging 0.97
IGL02534:Pabpc1l APN 2 164027490 missense probably damaging 1.00
IGL02684:Pabpc1l APN 2 164031277 missense probably benign
R0371:Pabpc1l UTSW 2 164035272 missense probably benign 0.08
R0799:Pabpc1l UTSW 2 164031214 missense probably benign
R1203:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1548:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1549:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1687:Pabpc1l UTSW 2 164044306 missense probably benign 0.00
R1928:Pabpc1l UTSW 2 164032254 missense possibly damaging 0.70
R2698:Pabpc1l UTSW 2 164044382 critical splice donor site probably null
R3925:Pabpc1l UTSW 2 164027676 splice site probably benign
R3944:Pabpc1l UTSW 2 164042327 missense probably damaging 1.00
R4052:Pabpc1l UTSW 2 164043613 missense probably benign 0.20
R4793:Pabpc1l UTSW 2 164027622 missense possibly damaging 0.94
R5001:Pabpc1l UTSW 2 164042518 missense probably benign 0.00
R5104:Pabpc1l UTSW 2 164043587 missense probably benign 0.00
R5456:Pabpc1l UTSW 2 164027660 missense probably damaging 1.00
R5569:Pabpc1l UTSW 2 164043554 missense probably benign 0.00
R5853:Pabpc1l UTSW 2 164049518 missense probably benign 0.00
R5857:Pabpc1l UTSW 2 164044255 splice site probably null
R7107:Pabpc1l UTSW 2 164042479 missense probably damaging 0.99
R7650:Pabpc1l UTSW 2 164049590 missense probably benign 0.28
T0722:Pabpc1l UTSW 2 164042420 missense possibly damaging 0.89
Z1088:Pabpc1l UTSW 2 164032324 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGGTGGGCAAAGCACAACC -3'
(R):5'- AACCCAAAGTCTCTGGAAGCTAACG -3'

Sequencing Primer
(F):5'- ATGGTCCCCCTGTGTGAAAG -3'
(R):5'- TGTACAGGGTTAAGAACCTGG -3'
Posted On2014-01-15