Incidental Mutation 'R1202:Cct3'
ID100182
Institutional Source Beutler Lab
Gene Symbol Cct3
Ensembl Gene ENSMUSG00000001416
Gene Namechaperonin containing Tcp1, subunit 3 (gamma)
SynonymsCctg, Tcp1-rs3, TriC-P5
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88297116-88321767 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88318528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000164166] [ENSMUST00000164166] [ENSMUST00000168062]
Predicted Effect probably null
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163735
SMART Domains Protein: ENSMUSP00000130616
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 2 115 4.7e-22 PFAM
Pfam:Cpn60_TCP1 106 306 8.4e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163735
SMART Domains Protein: ENSMUSP00000130616
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 2 115 4.7e-22 PFAM
Pfam:Cpn60_TCP1 106 306 8.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect probably null
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167718
Predicted Effect probably null
Transcript: ENSMUST00000168062
SMART Domains Protein: ENSMUSP00000131113
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 520 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants have been characterized for this gene. In addition, a pseudogene of this gene has been found on chromosome 8. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit lethality at E8. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Cct3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0068:Cct3 UTSW 3 88318465 missense probably benign 0.05
R0454:Cct3 UTSW 3 88302866 critical splice donor site probably null
R0799:Cct3 UTSW 3 88299345 unclassified probably null
R0883:Cct3 UTSW 3 88313557 missense probably damaging 1.00
R3889:Cct3 UTSW 3 88321027 missense probably benign 0.00
R4766:Cct3 UTSW 3 88311785 nonsense probably null
R5089:Cct3 UTSW 3 88300843 missense probably damaging 1.00
R5224:Cct3 UTSW 3 88297225 utr 5 prime probably benign
R5263:Cct3 UTSW 3 88321365 critical splice donor site probably null
R5772:Cct3 UTSW 3 88300967 missense probably damaging 1.00
R6026:Cct3 UTSW 3 88311722 missense possibly damaging 0.90
R7230:Cct3 UTSW 3 88313260 missense probably damaging 0.99
R7423:Cct3 UTSW 3 88309196 missense probably benign 0.05
R7810:Cct3 UTSW 3 88321135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCAGTTCAGACCTCTCAGTG -3'
(R):5'- AGACATGCAGCTACAGGCCAATG -3'

Sequencing Primer
(F):5'- CACAGACTGTGGACCACTAGATG -3'
(R):5'- caatgagcatggactgaaaataaaac -3'
Posted On2014-01-15