Incidental Mutation 'R1202:Fndc5'
ID100184
Institutional Source Beutler Lab
Gene Symbol Fndc5
Ensembl Gene ENSMUSG00000001334
Gene Namefibronectin type III domain containing 5
Synonyms1500001L03Rik, PeP, Pxp
MMRRC Submission 039272-MU
Accession Numbers

Genbank: NM_027402; MGI: 1917614  

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1202 (G1)
Quality Score220
Status Not validated
Chromosome4
Chromosomal Location129136999-129144593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129139445 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 102 (V102M)
Ref Sequence ENSEMBL: ENSMUSP00000099660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102600]
Predicted Effect probably damaging
Transcript: ENSMUST00000102600
AA Change: V102M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099660
Gene: ENSMUSG00000001334
AA Change: V102M

DomainStartEndE-ValueType
FN3 31 111 7.34e-9 SMART
Pfam:DUF4808 146 204 4.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124746
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Fndc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Fndc5 APN 4 129139446 missense probably damaging 1.00
IGL03336:Fndc5 APN 4 129139918 missense probably benign 0.00
N/A - 287:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
R0645:Fndc5 UTSW 4 129139837 splice site probably benign
R3962:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R4408:Fndc5 UTSW 4 129142529 splice site probably null
R5379:Fndc5 UTSW 4 129142094 missense probably damaging 1.00
R5539:Fndc5 UTSW 4 129138721 missense probably damaging 1.00
R6242:Fndc5 UTSW 4 129139895 missense probably benign 0.23
R6951:Fndc5 UTSW 4 129138780 missense possibly damaging 0.77
R7027:Fndc5 UTSW 4 129139523 missense probably benign 0.00
R7112:Fndc5 UTSW 4 129142122 missense probably benign 0.09
R8254:Fndc5 UTSW 4 129138721 missense possibly damaging 0.86
RF014:Fndc5 UTSW 4 129142167 missense probably benign 0.00
Z31818:Fndc5 UTSW 4 129139349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTCAAGTCCAAGGTCAGCCAG -3'
(R):5'- GGGCCGAAATCAACCCTTCTTCATC -3'

Sequencing Primer
(F):5'- cactctgacccctctgaac -3'
(R):5'- GAAATCAACCCTTCTTCATCTCTCG -3'
Posted On2014-01-15