Incidental Mutation 'R1202:9430007A20Rik'
ID100186
Institutional Source Beutler Lab
Gene Symbol 9430007A20Rik
Ensembl Gene ENSMUSG00000028593
Gene NameRIKEN cDNA 9430007A20 gene
SynonymsLOC381572
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144519822-144529353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144523666 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 137 (F137L)
Ref Sequence ENSEMBL: ENSMUSP00000030328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030328]
Predicted Effect probably benign
Transcript: ENSMUST00000030328
AA Change: F137L

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030328
Gene: ENSMUSG00000028593
AA Change: F137L

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Abhydrolase_3 115 286 6.2e-32 PFAM
Pfam:Abhydrolase_3 273 381 7.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120637
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in 9430007A20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:9430007A20Rik APN 4 144528622 missense possibly damaging 0.92
IGL01866:9430007A20Rik APN 4 144528549 missense possibly damaging 0.85
IGL02736:9430007A20Rik APN 4 144528637 missense probably benign 0.15
IGL02928:9430007A20Rik APN 4 144529232 missense possibly damaging 0.93
IGL03236:9430007A20Rik APN 4 144519916 missense probably benign 0.00
R0023:9430007A20Rik UTSW 4 144528997 missense probably damaging 1.00
R0023:9430007A20Rik UTSW 4 144528997 missense probably damaging 1.00
R0304:9430007A20Rik UTSW 4 144520049 missense probably benign 0.44
R0320:9430007A20Rik UTSW 4 144522420 missense probably damaging 1.00
R0987:9430007A20Rik UTSW 4 144519932 missense possibly damaging 0.81
R1124:9430007A20Rik UTSW 4 144528624 missense probably benign 0.00
R1708:9430007A20Rik UTSW 4 144519941 missense probably benign 0.36
R2238:9430007A20Rik UTSW 4 144519899 missense possibly damaging 0.88
R2334:9430007A20Rik UTSW 4 144528859 missense probably damaging 1.00
R2351:9430007A20Rik UTSW 4 144528778 missense probably damaging 1.00
R4913:9430007A20Rik UTSW 4 144528811 missense possibly damaging 0.93
R5153:9430007A20Rik UTSW 4 144522267 missense probably benign 0.06
R6312:9430007A20Rik UTSW 4 144528502 missense probably benign
R6379:9430007A20Rik UTSW 4 144522342 missense probably benign 0.10
R7555:9430007A20Rik UTSW 4 144522354 missense probably damaging 0.99
Z1088:9430007A20Rik UTSW 4 144528669 missense probably damaging 1.00
Z1177:9430007A20Rik UTSW 4 144528500 nonsense probably null
Z1177:9430007A20Rik UTSW 4 144528712 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATAACCAGGCTGTGTGCCTTGT -3'
(R):5'- GAGGCCCTTTTCTCATTTGCATGATG -3'

Sequencing Primer
(F):5'- TGTATAAAACCTGGTCCCACGAG -3'
(R):5'- GCTATGTCCATAGGTAAGAGCTTCTC -3'
Posted On2014-01-15