Incidental Mutation 'R1202:Nphp4'
ID100188
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 152488729 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably null
Transcript: ENSMUST00000056567
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081393
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153759
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Usp17lb G A 7: 104,842,488 S6F probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1366:Nphp4 UTSW 4 152502926 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
R8346:Nphp4 UTSW 4 152561321 missense probably damaging 1.00
R8479:Nphp4 UTSW 4 152524290 missense probably benign 0.01
R8847:Nphp4 UTSW 4 152506406 missense probably damaging 1.00
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152518196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCACGAGATGAAGAAATCCACC -3'
(R):5'- GCTGACAGAACCACCTACCTCATTG -3'

Sequencing Primer
(F):5'- ATCATCTGAGGGCATTTCAGC -3'
(R):5'- ACCTACCTCATTGAAGGTGATCC -3'
Posted On2014-01-15