Incidental Mutation 'R1202:Usp17lb'
ID100203
Institutional Source Beutler Lab
Gene Symbol Usp17lb
Ensembl Gene ENSMUSG00000062369
Gene Nameubiquitin specific peptidase 17-like B
Synonyms
MMRRC Submission 039272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R1202 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104840257-104842603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104842488 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 6 (S6F)
Ref Sequence ENSEMBL: ENSMUSP00000102427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076501] [ENSMUST00000106814]
Predicted Effect probably damaging
Transcript: ENSMUST00000076501
AA Change: S6F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075822
Gene: ENSMUSG00000062369
AA Change: S6F

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.2e-55 PFAM
Pfam:UCH_1 51 327 6.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106814
AA Change: S6F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102427
Gene: ENSMUSG00000062369
AA Change: S6F

DomainStartEndE-ValueType
Pfam:UCH 49 344 2.3e-61 PFAM
Pfam:UCH_1 50 326 1.5e-30 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.6%
  • 20x: 86.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik T C 4: 144,523,666 F137L probably benign Het
Cct3 T C 3: 88,318,528 probably null Het
Fermt3 A G 19: 7,003,482 F294L probably damaging Het
Fmn2 A T 1: 174,612,535 K58* probably null Het
Fndc5 G A 4: 129,139,445 V102M probably damaging Het
Gle1 C T 2: 29,949,265 A523V probably damaging Het
Hoxd11 C T 2: 74,682,577 A62V possibly damaging Het
Il23r A G 6: 67,478,953 V177A possibly damaging Het
Impdh2 G A 9: 108,563,187 R224Q probably damaging Het
Larp4b A G 13: 9,166,326 T516A possibly damaging Het
Mtmr2 T C 9: 13,803,452 Y431H probably benign Het
N4bp1 T C 8: 86,844,887 T828A probably benign Het
Nphp4 G A 4: 152,488,729 probably null Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Pabpc1l G T 2: 164,037,171 V313F possibly damaging Het
Pacs1 G A 19: 5,135,237 P885S probably damaging Het
Scn3a T C 2: 65,506,147 N705S probably benign Het
Sema4g G T 19: 44,998,257 R383L probably benign Het
Slc26a10 A G 10: 127,173,348 L648P probably damaging Het
St8sia2 A T 7: 73,972,035 V37E probably benign Het
Tmem209 C G 6: 30,508,790 V6L probably benign Het
Tmprss11a T A 5: 86,411,925 probably null Het
Ube2o C T 11: 116,541,582 D853N probably damaging Het
Vmn2r74 G A 7: 85,961,337 T49I possibly damaging Het
Zfp236 T A 18: 82,628,166 T1041S probably benign Het
Other mutations in Usp17lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Usp17lb APN 7 104841229 missense probably damaging 0.98
IGL01571:Usp17lb APN 7 104840381 missense possibly damaging 0.59
IGL01624:Usp17lb APN 7 104842513 utr 5 prime probably benign
IGL02582:Usp17lb APN 7 104840730 missense probably damaging 1.00
IGL03193:Usp17lb APN 7 104841277 missense possibly damaging 0.46
R0399:Usp17lb UTSW 7 104841151 missense possibly damaging 0.81
R0420:Usp17lb UTSW 7 104840539 missense probably benign
R1628:Usp17lb UTSW 7 104840841 missense probably damaging 1.00
R2085:Usp17lb UTSW 7 104840415 missense possibly damaging 0.73
R2214:Usp17lb UTSW 7 104841432 missense probably benign 0.36
R2283:Usp17lb UTSW 7 104840652 missense possibly damaging 0.68
R2866:Usp17lb UTSW 7 104840748 missense probably damaging 1.00
R3433:Usp17lb UTSW 7 104841648 missense possibly damaging 0.89
R5004:Usp17lb UTSW 7 104841677 missense probably benign 0.00
R5090:Usp17lb UTSW 7 104841083 missense probably benign 0.06
R5143:Usp17lb UTSW 7 104841478 missense probably damaging 1.00
R5366:Usp17lb UTSW 7 104840408 missense possibly damaging 0.95
R5568:Usp17lb UTSW 7 104841208 missense probably damaging 1.00
R5605:Usp17lb UTSW 7 104840640 missense probably benign 0.00
R5647:Usp17lb UTSW 7 104840674 missense possibly damaging 0.92
R5981:Usp17lb UTSW 7 104841187 missense probably damaging 1.00
R5999:Usp17lb UTSW 7 104840345 missense probably damaging 0.99
R6114:Usp17lb UTSW 7 104840364 missense possibly damaging 0.87
R6185:Usp17lb UTSW 7 104841424 missense probably benign 0.22
R6279:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6300:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6891:Usp17lb UTSW 7 104841100 missense probably benign 0.02
R7000:Usp17lb UTSW 7 104841285 missense probably damaging 1.00
R7137:Usp17lb UTSW 7 104841591 missense probably benign 0.15
R7318:Usp17lb UTSW 7 104841133 missense probably benign 0.03
R7372:Usp17lb UTSW 7 104841706 splice site probably null
R7809:Usp17lb UTSW 7 104841213 missense probably damaging 1.00
R7834:Usp17lb UTSW 7 104841511 missense probably damaging 1.00
R8008:Usp17lb UTSW 7 104841274 missense possibly damaging 0.82
R8283:Usp17lb UTSW 7 104840806 missense probably damaging 0.98
R8385:Usp17lb UTSW 7 104840623 missense possibly damaging 0.82
X0021:Usp17lb UTSW 7 104841316 missense probably damaging 1.00
Z1088:Usp17lb UTSW 7 104841129 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAACTTCTTAGAAGGGCAGACCAGC -3'
(R):5'- ACATTGGAGCAAGGGAAATGCACTC -3'

Sequencing Primer
(F):5'- AGCCCTTTTGTCATCAAAAGC -3'
(R):5'- TGCACTCCAAAGAGATGAGATTACTG -3'
Posted On2014-01-15